Non-numeric argument to mathematical function dbinom #4

ahorn720 · 2020-11-10T00:37:38Z

Im very excited to use this software, thank you so much for preparing it.

I've run into an issue with a finicky sample can I can't figure out what's wrong.

ccfs = list()
for (sample in samples) {
  x = init(snvs = snvs%>%filter(Samples==sample),
           cna = cnvs%>%filter(Samples==sample),
           purity = purity%>%filter(Samples==sample)%>%select(Purity),
           ref = "hg38")
  ccf = compute_CCF(x)
  ccf.data = CCF(ccf)
  ccf.data$CCF[ccf.data$CCF>=1] = 1
  ccfs[[sample]] = ccf.data
}

However I get an error for only one of my samples at this function...

>   ccf = compute_CCF(x)
── Computing mutation multiplicity for karyotype 2:0 using raw VAF cuts. ──────────────────────────────────────────────
ℹ Expected Binomial peak(s) for these calls (1 and 2 copies): .
Error in qbinom(quantile_left, n, p) : 
  Non-numeric argument to mathematical function

its worth noting that all the samples before this one had a Karyotype of 1:1 but this sample had 2:0.

Any suggestions?

Thank you!

> sessionInfo()
R version 4.0.2 (2020-06-22)
Platform: x86_64-apple-darwin17.0 (64-bit)
Running under: macOS Catalina 10.15.7

Matrix products: default
BLAS:   /System/Library/Frameworks/Accelerate.framework/Versions/A/Frameworks/vecLib.framework/Versions/A/libBLAS.dylib
LAPACK: /Library/Frameworks/R.framework/Versions/4.0/Resources/lib/libRlapack.dylib

locale:
[1] en_US.UTF-8/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8

attached base packages:
[1] stats     graphics  grDevices utils     datasets  methods   base     

other attached packages:
 [1] wesanderson_0.3.6  ggsci_2.9          CNAqc_0.1.0        RColorBrewer_1.1-2 peakPick_0.11      ggpubr_0.4.0      
 [7] crayon_1.3.4       pio_0.1.0          forcats_0.5.0      stringr_1.4.0      dplyr_1.0.2        purrr_0.3.4       
[13] readr_1.3.1        tidyr_1.1.2        tibble_3.0.4       ggplot2_3.3.2      tidyverse_1.3.0   

loaded via a namespace (and not attached):
 [1] fs_1.5.0            usethis_1.6.3       lubridate_1.7.9     devtools_2.3.2      httr_1.4.2         
 [6] rprojroot_1.3-2     tools_4.0.2         backports_1.1.10    utf8_1.1.4          R6_2.4.1           
[11] DBI_1.1.0           colorspace_1.4-1    withr_2.3.0         tidyselect_1.1.0    prettyunits_1.1.1  
[16] processx_3.4.4      curl_4.3            compiler_4.0.2      cli_2.1.0           rvest_0.3.6        
[21] xml2_1.3.2          desc_1.2.0          labeling_0.3        scales_1.1.1        callr_3.4.4        
[26] digest_0.6.27       foreign_0.8-80      rmarkdown_2.3       rio_0.5.16          pkgconfig_2.0.3    
[31] htmltools_0.5.0     sessioninfo_1.1.1   dbplyr_1.4.4        rlang_0.4.8         readxl_1.3.1       
[36] rstudioapi_0.11     farver_2.0.3        generics_0.0.2      jsonlite_1.7.1      zip_2.1.1          
[41] car_3.0-9           magrittr_1.5        Rcpp_1.0.5          munsell_0.5.0       fansi_0.4.1        
[46] abind_1.4-5         lifecycle_0.2.0     stringi_1.5.3       yaml_2.2.1          carData_3.0-4      
[51] pkgbuild_1.1.0      grid_4.0.2          blob_1.2.1          ggrepel_0.8.2       cowplot_1.1.0      
[56] haven_2.3.1         hms_0.5.3           knitr_1.30          ps_1.3.4            pillar_1.4.6       
[61] ggsignif_0.6.0      pkgload_1.1.0       reprex_0.3.0        glue_1.4.2          evaluate_0.14      
[66] data.table_1.13.0   remotes_2.2.0       BiocManager_1.30.10 modelr_0.1.8        vctrs_0.3.4        
[71] testthat_2.3.2      cellranger_1.1.0    gtable_0.3.0        assertthat_0.2.1    openxlsx_4.2.2     
[76] xfun_0.17           broom_0.7.0         rstatix_0.6.0       memoise_1.1.0       ellipsis_0.3.1

The text was updated successfully, but these errors were encountered:

ahorn720 · 2020-11-10T00:53:40Z

after some further digging I believe I've found where the issue is occurring.

the if/then statements within compute_CCF lead to mutmult_two_copies_entropy where at lines 14 and 15 a couple values aren't made...which are then put into the dbinom function which of course won't work without those values.

> x
── [ CNAqc ]  n = 125 mutations in 237 segments (237 clonal + 0 subclonal). Genome reference: hg38. ───────────────────

 2:0  [n = 125, L = 178 Mb] ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■

ℹ Sample Purity: 80.5% ~ Ploidy: 2.
> karyotype
[1] "2:0"

>   cli::cli_rule("Computing mutation multiplicity for karyotype {.field {karyotype}} using the entropy method.")
── Computing mutation multiplicity for karyotype 2:0 using the entropy method. ────────────────────────────────────────
>   A = as.numeric(strsplit(karyotype, ":")[[1]][1])
>   B = as.numeric(strsplit(karyotype, ":")[[1]][2])
>   cl_seg = x$cna %>% dplyr::filter(CCF == 1) %>% dplyr::pull(segment_id)
>   snvs_k = x$snvs %>% dplyr::filter(karyotype == !!karyotype, 
+     segment_id %in% cl_seg)
>   expectation = CNAqc:::expected_vaf_peak(A, B, x$purity) %>% 
+     mutate(label = ifelse(mutation_multiplicity == 1, "One copy", 
+       "Two copies"))
>   med_coverage = median(snvs_k$DP, na.rm = TRUE)
>   cli::cli_alert_info("Expected Binomial peak(s) for these calls (1 and 2 copies): {.value {expectation$peak}}")
ℹ Expected Binomial peak(s) for these calls (1 and 2 copies): 
Warning message:
Unknown or uninitialised column: `peak`. 
>   p_1 = expectation$peak[1]
Warning message:
Unknown or uninitialised column: `peak`. 
>   p_2 = expectation$peak[2]
Warning message:
Unknown or uninitialised column: `peak`.

the table expectation actually looks like this:

> expectation
# A tibble: 2 x 5
  mutation_multiplicity karyotype peak.Purity peak.Purity.1 label     
                  <dbl> <chr>           <dbl>         <dbl> <chr>     
1                     1 2:0             0.402         0.805 One copy  
2                     2 2:0             0.402         0.805 Two copies

so maybe it needs to have the column names renamed or something like that.

ahorn720 · 2020-11-17T00:37:10Z

Just thought I'd ping this comment in case it was forgotten. Thank you in advance for spending the time to work on this

luca-dex · 2020-11-17T00:49:42Z

Hi @ahorn720 thanks for pointing this out

We'll have a look

caravagn · 2020-11-17T12:40:47Z

Well this is interesting thanks @ahorn720 . I can definitely debug this for you and I am sure it must be some simple type of error. Is there any chance you could share with me the object x you pass to CNAqc ccf = compute_CCF(x)? In theory I do not all the muts, but maybe only those that generate the error (also you can anonimise your data any way you like).

caravagn · 2020-11-17T12:42:02Z

certainly peak.Purity.1 should not be there, but I need to run it line-by-line to see where that comes out from - it might be some change in the underlying managment of tibble names by tidyverse packages.

caravagn · 2020-11-17T12:42:41Z

I can say that running it on several different datasets over the last few weeks never raised this error to me, so I presume is something really simple to fix (maybe some NA where there should be none).

ahorn720 · 2020-11-17T18:14:09Z

Hi Caravagn! Sure thing. Here is a reprex::reprex of the first issue I ran into which led me to that bug.

library(CNAqc)
#> ✓ Loading CNAqc, 'Copy Number Alteration quality check'. Support : <https://caravagn.github.io/CNAqc/>
load("~/Desktop/cnaquestion.RData",verbose = T)
#> Loading objects:
#>   snvs
#>   cna
#>   purity
#>   ref

data.frame(snvs)
#>      chr      from        to          ref
#> 1   chr5 112740514 112740517            G
#> 2   chr5 112740524 112740526           CT
#> 3   chr5 112742073 112742074            A
#> 4   chr5 112742223 112742224            G
#> 5   chr5 112743064 112743065            A
#> 6   chr5 112745548 112745544         TTTA
#> 7   chr5 112745548 112745552         TTTA
#> 8   chr5 112745575 112745579            A
#> 9   chr5 112746162 112746163            A
#> 10  chr5 112747086 112747087            T
#> 11  chr5 112747109 112747110            A
#> 12  chr5 112748712 112748713            G
#> 13  chr5 112748724 112748725            G
#> 14  chr5 112748726 112748727            T
#> 15  chr5 112748928 112748929            A
#> 16  chr5 112749479 112749481           AT
#> 17  chr5 112749479 112749483           AT
#> 18  chr5 112749479 112749482           AT
#> 19  chr5 112749479 112749477           AT
#> 20  chr5 112749968 112749970            G
#> 21  chr5 112751050 112751051            C
#> 22  chr5 112753585 112753586            T
#> 23  chr5 112753783 112753784            T
#> 24  chr5 112758873 112758874            A
#> 25  chr5 112759356 112759358           CT
#> 26  chr5 112759356 112759354           CT
#> 27  chr5 112764078 112764075        TAAAA
#> 28  chr5 112764078 112764076        TAAAA
#> 29  chr5 112764245 112764247           CA
#> 30  chr5 112767811 112767812            G
#> 31  chr5 112768363 112768361           CA
#> 32  chr5 112768363 112768365           CA
#> 33  chr5 112768513 112768515           CT
#> 34  chr5 112769050 112769048         CTTT
#> 35  chr5 112769050 112769052         CTTT
#> 36  chr5 112769050 112769053         CTTT
#> 37  chr5 112769050 112769046         CTTT
#> 38  chr5 112771351 112771352            G
#> 39  chr5 112774464 112774466            A
#> 40  chr5 112774464 112774467            A
#> 41  chr5 112774464 112774468            A
#> 42  chr5 112775605 112775607            C
#> 43  chr5 112776137 112776138            C
#> 44  chr5 112776862 112776860           TA
#> 45  chr5 112778550 112778552            A
#> 46  chr5 112778550 112778553            A
#> 47  chr5 112778688 112778692            A
#> 48  chr5 112778834 112778835            C
#> 49  chr5 112781763 112781761           AT
#> 50  chr5 112781763 112781765           AT
#> 51  chr5 112783765 112783763           CA
#> 52  chr5 112783765 112783767           CA
#> 53  chr5 112783765 112783769           CA
#> 54  chr5 112783786 112783787            A
#> 55  chr5 112783796 112783790       GAAAGA
#> 56  chr5 112786886 112786884           CT
#> 57  chr5 112786886 112786888           CT
#> 58  chr5 112786905 112786901         TGAG
#> 59  chr5 112789691 112789692            A
#> 60  chr5 112789857 112789859            A
#> 61  chr5 112792467 112792468            C
#> 62  chr5 112794137 112794138            G
#> 63  chr5 112794389 112794390            C
#> 64  chr5 112799163 112799164            G
#> 65  chr5 112799183 112799185            C
#> 66  chr5 112800832 112800829          CAT
#> 67  chr5 112803976 112803977            C
#> 68  chr5 112804460 112804461            A
#> 69  chr5 112804461 112804462            T
#> 70  chr5 112804641 112804642            T
#> 71  chr5 112805008 112805006           TA
#> 72  chr5 112805530 112805531            T
#> 73  chr5 112806552 112806557    CTTTATTTA
#> 74  chr5 112806552 112806543    CTTTATTTA
#> 75  chr5 112806552 112806547    CTTTATTTA
#> 76  chr5 112809971 112809973            T
#> 77  chr5 112813752 112813754           TA
#> 78  chr5 112813752 112813750           TA
#> 79  chr5 112815564 112815565            C
#> 80  chr5 112818847 112818849            C
#> 81  chr5 112819301 112819302            G
#> 82  chr5 112819349 112819350            G
#> 83  chr5 112820182 112820179        GACAC
#> 84  chr5 112820182 112820177        GACAC
#> 85  chr5 112821030 112821032           AT
#> 86  chr5 112821030 112821028           AT
#> 87  chr5 112826600 112826597          AAC
#> 88  chr5 112828001 112828002            C
#> 89  chr5 112828457 112828455          TAA
#> 90  chr5 112828457 112828454          TAA
#> 91  chr5 112831113 112831111           AT
#> 92  chr5 112831212 112831213            G
#> 93  chr5 112833180 112833178          ATT
#> 94  chr5 112833180 112833177          ATT
#> 95  chr5 112834238 112834236           CT
#> 96  chr5 112834257 112834252        TTTTA
#> 97  chr5 112834260 112834258          TAA
#> 98  chr5 112834261 112834262            A
#> 99  chr5 112834661 112834662            G
#> 100 chr5 112835572 112835574           AT
#> 101 chr5 112836009 112836006  CTTTTTTTTTT
#> 102 chr5 112836009 112835999  CTTTTTTTTTT
#> 103 chr5 112836165 112836163          TCC
#> 104 chr5 112836165 112836162          TCC
#> 105 chr5 112836165 112836170          TCC
#> 106 chr5 112836165 112836171          TCC
#> 107 chr5 112836180 112836181            G
#> 108 chr5 112838773 112838767       TAAAAC
#> 109 chr5 112838934 112838935            C
#> 110 chr5 112839450 112839451            G
#> 111 chr5 112839474 112839475            C
#> 112 chr5 112839510 112839511            G
#> 113 chr5 112839514 112839508       TAAAAG
#> 114 chr5 112839524 112839525            G
#> 115 chr5 112839527 112839525           TG
#> 116 chr5 112839528 112839529            G
#> 117 chr5 112839558 112839559            G
#> 118 chr5 112839606 112839607            C
#> 119 chr5 112839627 112839628            G
#> 120 chr5 112839651 112839652            G
#> 121 chr5 112839693 112839694            C
#> 122 chr5 112839719 112839716          CTA
#> 123 chr5 112839720 112839718           TA
#> 124 chr5 112839722 112839717        TGTTC
#> 125 chr5 112839726 112839727            C
#> 126 chr5 112839740 112839742            C
#> 127 chr5 112839752 112839743    ATGTACTTC
#> 128 chr5 112839753 112839758            T
#> 129 chr5 112839782 112839779          TGA
#> 130 chr5 112839783 112839784            G
#> 131 chr5 112839787 112839785           GT
#> 132 chr5 112839822 112839810 TGCAGTGGAATG
#> 133 chr5 112839832 112839830           TG
#> 134 chr5 112839835 112839833           TA
#> 135 chr5 112839838 112839836           GT
#> 136 chr5 112839860 112839858           TC
#> 137 chr5 112839871 112839869           GC
#> 138 chr5 112839874 112839875            C
#> 139 chr5 112839875 112839873           TG
#> 140 chr5 112839879 112839880            C
#> 141 chr5 112839890 112839888           AC
#> 142 chr5 112839895 112839892          GCA
#> 143 chr5 112839898 112839892       GAAGTA
#> 144 chr5 112839919 112839917           CT
#> 145 chr5 112839942 112839943            C
#> 146 chr5 112840052 112840054            T
#> 147 chr5 112840054 112840052           CT
#> 148 chr5 112840056 112840053          TTA
#> 149 chr5 112840063 112840065            A
#> 150 chr5 112840072 112840070          CGG
#> 151 chr5 112840072 112840069          CGG
#> 152 chr5 112840078 112840076           GT
#> 153 chr5 112840233 112840296            G
#> 154 chr5 112840254 112840256            G
#>                                                                 alt DP NV
#> 1                                                               GTT 39  0
#> 2                                                               CTT  1  0
#> 3                                                                 G 46 42
#> 4                                                                 C 54 52
#> 5                                                                 G 34  0
#> 6                                                                 T 36  0
#> 7                                                           TTTATTA 36  0
#> 8                                                              ATTT 39 31
#> 9                                                                 G 37  0
#> 10                                                                C 38  0
#> 11                                                                G 38  0
#> 12                                                                A 34  0
#> 13                                                                C 34  0
#> 14                                                                G 34  0
#> 15                                                                G 36  0
#> 16                                                              ATT 21 19
#> 17                                                            ATTTT  2  0
#> 18                                                             ATTT  2  0
#> 19                                                                A  2  0
#> 20                                                               GT 43  0
#> 21                                                                T 36  0
#> 22                                                                C 47 38
#> 23                                                                C 42 36
#> 24                                                                G 42  0
#> 25                                                              CTT 37  0
#> 26                                                                C 37  0
#> 27                                                              TAA  0  0
#> 28                                                             TAAA 40 40
#> 29                                                              CAA  5  3
#> 30                                                                A 37  0
#> 31                                                                C 37  0
#> 32                                                              CAA 37  0
#> 33                                                              CTT 40  0
#> 34                                                              CTT  3  0
#> 35                                                            CTTTT 10  7
#> 36                                                           CTTTTT  3  0
#> 37                                                                C  3  0
#> 38                                                                T 39  0
#> 39                                                               AT  6  0
#> 40                                                              ATT 25 19
#> 41                                                             ATTT  6  0
#> 42                                                               CT 37  0
#> 43                                                                T 30  0
#> 44                                                                T 38  0
#> 45                                                               AT  6  2
#> 46                                                              ATT 26 22
#> 47                                                             AGGC 48 42
#> 48                                                                T 36  0
#> 49                                                                A 36  0
#> 50                                                              ATT 36  0
#> 51                                                                C 35  0
#> 52                                                              CAA 37  2
#> 53                                                            CAAAA 35  0
#> 54                                                                T 53  0
#> 55                                                                G 53  0
#> 56                                                                C 29  0
#> 57                                                              CTT 29  0
#> 58                                                                T 22  0
#> 59                                                                G 37  0
#> 60                                                               AT 37  0
#> 61                                                                T 36  0
#> 62                                                                A 34  0
#> 63                                                                A 61 52
#> 64                                                                A 47  0
#> 65                                                               CA 10 10
#> 66                                                                C 37  0
#> 67                                                                G 43  0
#> 68                                                                G 34  0
#> 69                                                                C 34  0
#> 70                                                                G 34  0
#> 71                                                                T 34  0
#> 72                                                                C 35  0
#> 73                                                    CTTTATTTATTTA 36  0
#> 74                                                                C 36  0
#> 75                                                            CTTTA 36  0
#> 76                                                               TG 38  0
#> 77                                                              TAA 39  0
#> 78                                                                T 39  0
#> 79                                                                T 37  0
#> 80                                                               CG 16 10
#> 81                                                                A 38  0
#> 82                                                                A 38  0
#> 83                                                              GAC 36  0
#> 84                                                                G 36  0
#> 85                                                              ATT 43  0
#> 86                                                                A 43  0
#> 87                                                                A 27  2
#> 88                                                                T 28  0
#> 89                                                               TA 36 31
#> 90                                                                T  5  0
#> 91                                                                A 39  0
#> 92                                                                A 40  0
#> 93                                                               AT 32 28
#> 94                                                                A  4  0
#> 95                                                                C 37  0
#> 96                                                                T 28  0
#> 97                                                               TA 16 15
#> 98                                                                T  1  0
#> 99                                                                A 47 41
#> 100                                                             ATT  2  0
#> 101                                                       CTTTTTTTT  0  0
#> 102                                                              CT  0  0
#> 103                                                              TC 13  0
#> 104                                                               T 13  0
#> 105                                                         TTCCCCC 13  0
#> 106                                                        TTCCCCCC 13  0
#> 107                                                               A  5  5
#> 108                                                               T 45  6
#> 109                                                               T 38  0
#> 110                                                               T 37  0
#> 111                                                               T 37  0
#> 112                                                               T 37  0
#> 113                                                               T 37 30
#> 114                                                               T 36  0
#> 115                                                               T 36  0
#> 116                                                               T 36  0
#> 117                                                               T 36  0
#> 118                                                               T 36  0
#> 119                                                               T 36  0
#> 120                                                               T 36  0
#> 121                                                               T 37  0
#> 122                                                               C 37  0
#> 123                                                               T 37  0
#> 124                                                               T 37  0
#> 125                                                               T 37  0
#> 126                                                              CA 37  0
#> 127                                                               A 37  0
#> 128                                                           TGTAC 37  0
#> 129                                                               T 37  0
#> 130                                                               T 37  0
#> 131                                                               G 37  0
#> 132                                                               T 37  0
#> 133                                                               T 37  0
#> 134                                                               T 37  0
#> 135                                                               G 37  0
#> 136                                                               T 37  0
#> 137                                                               G 37  0
#> 138                                                               T 37  0
#> 139                                                               T 37  0
#> 140                                                               T 37  0
#> 141                                                               A 37  0
#> 142                                                               G 37  0
#> 143                                                               G 37  0
#> 144                                                               C 37  0
#> 145                                                               T 37  0
#> 146                                                              TA 36  0
#> 147                                                               C 36  0
#> 148                                                               T 36  0
#> 149                                                              AT 36  0
#> 150                                                              CG 36  0
#> 151                                                               C 36  0
#> 152                                                               G 37  0
#> 153 GCTGGCATCTGGATTTCAGACTTCTGGCTTCCAGAACTGTGGAAGAAGACATCTCGTTGTTTT 35  0
#> 154                                                              GA 35  0
#>            VAF  Samples
#> 1   0.00000000 A002C204
#> 2   0.00000000 A002C204
#> 3   0.91304348 A002C204
#> 4   0.96296296 A002C204
#> 5   0.00000000 A002C204
#> 6   0.00000000 A002C204
#> 7   0.00000000 A002C204
#> 8   0.79487179 A002C204
#> 9   0.00000000 A002C204
#> 10  0.00000000 A002C204
#> 11  0.00000000 A002C204
#> 12  0.00000000 A002C204
#> 13  0.00000000 A002C204
#> 14  0.00000000 A002C204
#> 15  0.00000000 A002C204
#> 16  0.90476190 A002C204
#> 17  0.00000000 A002C204
#> 18  0.00000000 A002C204
#> 19  0.00000000 A002C204
#> 20  0.00000000 A002C204
#> 21  0.00000000 A002C204
#> 22  0.80851064 A002C204
#> 23  0.85714286 A002C204
#> 24  0.00000000 A002C204
#> 25  0.00000000 A002C204
#> 26  0.00000000 A002C204
#> 27  0.00000000 A002C204
#> 28  1.00000000 A002C204
#> 29  0.60000000 A002C204
#> 30  0.00000000 A002C204
#> 31  0.00000000 A002C204
#> 32  0.00000000 A002C204
#> 33  0.00000000 A002C204
#> 34  0.00000000 A002C204
#> 35  0.70000000 A002C204
#> 36  0.00000000 A002C204
#> 37  0.00000000 A002C204
#> 38  0.00000000 A002C204
#> 39  0.00000000 A002C204
#> 40  0.76000000 A002C204
#> 41  0.00000000 A002C204
#> 42  0.00000000 A002C204
#> 43  0.00000000 A002C204
#> 44  0.00000000 A002C204
#> 45  0.33333333 A002C204
#> 46  0.84615385 A002C204
#> 47  0.87500000 A002C204
#> 48  0.00000000 A002C204
#> 49  0.00000000 A002C204
#> 50  0.00000000 A002C204
#> 51  0.00000000 A002C204
#> 52  0.05405405 A002C204
#> 53  0.00000000 A002C204
#> 54  0.00000000 A002C204
#> 55  0.00000000 A002C204
#> 56  0.00000000 A002C204
#> 57  0.00000000 A002C204
#> 58  0.00000000 A002C204
#> 59  0.00000000 A002C204
#> 60  0.00000000 A002C204
#> 61  0.00000000 A002C204
#> 62  0.00000000 A002C204
#> 63  0.85245902 A002C204
#> 64  0.00000000 A002C204
#> 65  1.00000000 A002C204
#> 66  0.00000000 A002C204
#> 67  0.00000000 A002C204
#> 68  0.00000000 A002C204
#> 69  0.00000000 A002C204
#> 70  0.00000000 A002C204
#> 71  0.00000000 A002C204
#> 72  0.00000000 A002C204
#> 73  0.00000000 A002C204
#> 74  0.00000000 A002C204
#> 75  0.00000000 A002C204
#> 76  0.00000000 A002C204
#> 77  0.00000000 A002C204
#> 78  0.00000000 A002C204
#> 79  0.00000000 A002C204
#> 80  0.62500000 A002C204
#> 81  0.00000000 A002C204
#> 82  0.00000000 A002C204
#> 83  0.00000000 A002C204
#> 84  0.00000000 A002C204
#> 85  0.00000000 A002C204
#> 86  0.00000000 A002C204
#> 87  0.07407407 A002C204
#> 88  0.00000000 A002C204
#> 89  0.86111111 A002C204
#> 90  0.00000000 A002C204
#> 91  0.00000000 A002C204
#> 92  0.00000000 A002C204
#> 93  0.87500000 A002C204
#> 94  0.00000000 A002C204
#> 95  0.00000000 A002C204
#> 96  0.00000000 A002C204
#> 97  0.93750000 A002C204
#> 98  0.00000000 A002C204
#> 99  0.87234043 A002C204
#> 100 0.00000000 A002C204
#> 101 0.00000000 A002C204
#> 102 0.00000000 A002C204
#> 103 0.00000000 A002C204
#> 104 0.00000000 A002C204
#> 105 0.00000000 A002C204
#> 106 0.00000000 A002C204
#> 107 1.00000000 A002C204
#> 108 0.13333333 A002C204
#> 109 0.00000000 A002C204
#> 110 0.00000000 A002C204
#> 111 0.00000000 A002C204
#> 112 0.00000000 A002C204
#> 113 0.81081081 A002C204
#> 114 0.00000000 A002C204
#> 115 0.00000000 A002C204
#> 116 0.00000000 A002C204
#> 117 0.00000000 A002C204
#> 118 0.00000000 A002C204
#> 119 0.00000000 A002C204
#> 120 0.00000000 A002C204
#> 121 0.00000000 A002C204
#> 122 0.00000000 A002C204
#> 123 0.00000000 A002C204
#> 124 0.00000000 A002C204
#> 125 0.00000000 A002C204
#> 126 0.00000000 A002C204
#> 127 0.00000000 A002C204
#> 128 0.00000000 A002C204
#> 129 0.00000000 A002C204
#> 130 0.00000000 A002C204
#> 131 0.00000000 A002C204
#> 132 0.00000000 A002C204
#> 133 0.00000000 A002C204
#> 134 0.00000000 A002C204
#> 135 0.00000000 A002C204
#> 136 0.00000000 A002C204
#> 137 0.00000000 A002C204
#> 138 0.00000000 A002C204
#> 139 0.00000000 A002C204
#> 140 0.00000000 A002C204
#> 141 0.00000000 A002C204
#> 142 0.00000000 A002C204
#> 143 0.00000000 A002C204
#> 144 0.00000000 A002C204
#> 145 0.00000000 A002C204
#> 146 0.00000000 A002C204
#> 147 0.00000000 A002C204
#> 148 0.00000000 A002C204
#> 149 0.00000000 A002C204
#> 150 0.00000000 A002C204
#> 151 0.00000000 A002C204
#> 152 0.00000000 A002C204
#> 153 0.00000000 A002C204
#> 154 0.00000000 A002C204
data.frame(cna)
#>     chr      from        to Major minor  Samples
#> 1     1    822668   1985814     1     1 A002C204
#> 2     1   1985815   2008141     2     2 A002C204
#> 3     1   2008142  13911153     1     1 A002C204
#> 4     1  13911154  13959414     3     0 A002C204
#> 5     1  13959415 121764540     1     1 A002C204
#> 6     1 121764541 121782089     2     0 A002C204
#> 7     1 121782090 122632098     2     1 A002C204
#> 8     1 122632099 122684264     2     0 A002C204
#> 9     1 122684265 123395250     2     1 A002C204
#> 10    1 123395251 123409594     4     0 A002C204
#> 11    1 123409595 123764103     2     1 A002C204
#> 12    1 123764104 124909534     3     1 A002C204
#> 13    1 124909535 125073299     1     1 A002C204
#> 14    1 125073300 125115406     2     0 A002C204
#> 15    1 125115407 134442991     2     1 A002C204
#> 16    1 134442992 153687686     1     1 A002C204
#> 17    1 153687687 153725910     2     1 A002C204
#> 18    1 153725911 160695304     1     1 A002C204
#> 19    1 160695305 160697028     2     0 A002C204
#> 20    1 160697029 234775059     1     1 A002C204
#> 21    1 234775060 234782142     3     1 A002C204
#> 22    1 234782143 248903660     1     1 A002C204
#> 23    2     10797  89353653     1     1 A002C204
#> 24    2  89353654  89958704     2     1 A002C204
#> 25    2  89958705  90807134     1     1 A002C204
#> 26    2  90807135  94158750     2     1 A002C204
#> 27    2  94158751 240879852     1     1 A002C204
#> 28    2 240879853 240883002     2     2 A002C204
#> 29    2 240883003 242058566     1     1 A002C204
#> 30    3     57400  90748398     1     1 A002C204
#> 31    3  90748399  93254302     2     1 A002C204
#> 32    3  93254303 190199629     1     1 A002C204
#> 33    3 190199630 190202394     5     3 A002C204
#> 34    3 190202395 195697804     1     1 A002C204
#> 35    3 195697805 195711892     2     1 A002C204
#> 36    3 195711893 198113136     1     1 A002C204
#> 37    4     85866  42771923     1     1 A002C204
#> 38    4  42771924  42773322     2     0 A002C204
#> 39    4  42773323  49360128     1     1 A002C204
#> 40    4  49360129  49640652     4     0 A002C204
#> 41    4  49640653  50512170     2     1 A002C204
#> 42    4  50512171 188504076     1     1 A002C204
#> 43    4 188504077 188507054     1     0 A002C204
#> 44    4 188507055 189872692     1     1 A002C204
#> 45    5     12041  46512789     2     0 A002C204
#> 46    5  46512790  50148080     2     1 A002C204
#> 47    5  50148081 159916549     2     0 A002C204
#> 48    5 159916550 159924351     1     1 A002C204
#> 49    5 159924352 175911088     2     0 A002C204
#> 50    5 175911089 176032464     1     1 A002C204
#> 51    5 176032465 181271629     2     0 A002C204
#> 52    6    171649    250034     1     1 A002C204
#> 53    6    250035    382392     2     1 A002C204
#> 54    6    382393  35781648     1     1 A002C204
#> 55    6  35781649  35799023     2     1 A002C204
#> 56    6  35799024  60232108     1     1 A002C204
#> 57    6  60232109  60235249     2     0 A002C204
#> 58    6  60235250 155026833     1     1 A002C204
#> 59    6 155026834 155029916     4     4 A002C204
#> 60    6 155029917 170597327     1     1 A002C204
#> 61    7     41888  62342668     2     1 A002C204
#> 62    7  62342669  62343413     2     0 A002C204
#> 63    7  62343414  81358228     2     1 A002C204
#> 64    7  81358229  81359971     2     0 A002C204
#> 65    7  81359972 100952610     2     1 A002C204
#> 66    7 100952611 100961172     3     1 A002C204
#> 67    7 100961173 144779724     2     1 A002C204
#> 68    7 144779725 144781900     4     4 A002C204
#> 69    7 144781901 159329969     2     1 A002C204
#> 70    8    220692   6957548     1     1 A002C204
#> 71    8   6957549   8646974     2     1 A002C204
#> 72    8   8646975   8824464     1     1 A002C204
#> 73    8   8824465   8948930     2     1 A002C204
#> 74    8   8948931   9069558     1     1 A002C204
#> 75    8   9069559   9243576     2     1 A002C204
#> 76    8   9243577   9370558     1     1 A002C204
#> 77    8   9370559   9456231     2     1 A002C204
#> 78    8   9456232  13032581     1     1 A002C204
#> 79    8  13032582  13053099     2     1 A002C204
#> 80    8  13053100  21760352     1     1 A002C204
#> 81    8  21760353  22099509     2     1 A002C204
#> 82    8  22099510  22725141     1     1 A002C204
#> 83    8  22725142  22990366     2     1 A002C204
#> 84    8  22990367  25038967     1     1 A002C204
#> 85    8  25038968  25158108     2     1 A002C204
#> 86    8  25158109  25927974     1     1 A002C204
#> 87    8  25927975  26226254     2     1 A002C204
#> 88    8  26226255  37523720     1     1 A002C204
#> 89    8  37523721  38597754     2     1 A002C204
#> 90    8  38597755  39994712     1     1 A002C204
#> 91    8  39994713  40269844     2     1 A002C204
#> 92    8  40269845  41334544     1     1 A002C204
#> 93    8  41334545  41476523     2     1 A002C204
#> 94    8  41476524  42102888     1     1 A002C204
#> 95    8  42102889  42783768     2     1 A002C204
#> 96    8  42783769  69844424     1     1 A002C204
#> 97    8  69844425  70021513     2     1 A002C204
#> 98    8  70021514  72181818     1     1 A002C204
#> 99    8  72181819  72183076     4     2 A002C204
#> 100   8  72183077  80155517     1     1 A002C204
#> 101   8  80155518  80592485     2     1 A002C204
#> 102   8  80592486  94620405     1     1 A002C204
#> 103   8  94620406  94966532     2     1 A002C204
#> 104   8  94966533  97433968     1     1 A002C204
#> 105   8  97433969  97819902     2     1 A002C204
#> 106   8  97819903 102421227     1     1 A002C204
#> 107   8 102421228 102715420     2     1 A002C204
#> 108   8 102715421 119841344     1     1 A002C204
#> 109   8 119841345 120159806     2     1 A002C204
#> 110   8 120159807 125243048     1     1 A002C204
#> 111   8 125243049 125481604     2     1 A002C204
#> 112   8 125481605 127589052     1     1 A002C204
#> 113   8 127589053 127828578     2     1 A002C204
#> 114   8 127828579 133533319     1     1 A002C204
#> 115   8 133533320 133704132     2     1 A002C204
#> 116   8 133704133 139996605     1     1 A002C204
#> 117   8 139996606 142188974     2     1 A002C204
#> 118   8 142188975 142379368     1     1 A002C204
#> 119   8 142379369 142657086     2     1 A002C204
#> 120   8 142657087 142837858     1     1 A002C204
#> 121   8 142837859 143521131     2     1 A002C204
#> 122   8 143521132 143617574     1     1 A002C204
#> 123   8 143617575 144962821     2     1 A002C204
#> 124   8 144962822 145071631     1     1 A002C204
#> 125   9    204014  39180130     1     1 A002C204
#> 126   9  39180131  40912086     2     1 A002C204
#> 127   9  40912087  40915793     2     0 A002C204
#> 128   9  40915794  62869874     2     1 A002C204
#> 129   9  62869875 129404868     1     1 A002C204
#> 130   9 129404869 129485292     2     1 A002C204
#> 131   9 129485293 138124865     1     1 A002C204
#> 132  10     91366  38242652     1     1 A002C204
#> 133  10  38242653  38522852     2     1 A002C204
#> 134  10  38522853  38690962     1     1 A002C204
#> 135  10  38690963  38813996     2     1 A002C204
#> 136  10  38813997  38816054     2     0 A002C204
#> 137  10  38816055  38941858     2     1 A002C204
#> 138  10  38941859  39571988     1     1 A002C204
#> 139  10  39571989  41522648     2     1 A002C204
#> 140  10  41522649  41530557     2     0 A002C204
#> 141  10  41530558  41649224     2     1 A002C204
#> 142  10  41649225  42231738     1     1 A002C204
#> 143  10  42231739  42303078     2     0 A002C204
#> 144  10  42303079  46522963     1     1 A002C204
#> 145  10  46522964  46541968     2     1 A002C204
#> 146  10  46541969 108547330     1     1 A002C204
#> 147  10 108547331 108549138     5     3 A002C204
#> 148  10 108549139 133622305     1     1 A002C204
#> 149  11    196944  51155272     1     1 A002C204
#> 150  11  51155273  54545390     2     1 A002C204
#> 151  11  54545391 135075590     1     1 A002C204
#> 152  12     21064     38052     1     1 A002C204
#> 153  12     38053     70274     2     1 A002C204
#> 154  12     70275  34801010     1     1 A002C204
#> 155  12  34801011  37262642     2     1 A002C204
#> 156  12  37262643 133240522     1     1 A002C204
#> 157  13  16003441  38955993     2     1 A002C204
#> 158  13  38955994  38956733     6     2 A002C204
#> 159  13  38956734 114328229     2     1 A002C204
#> 160  14  16097169  16109122     1     0 A002C204
#> 161  14  16109123  16137230     2     1 A002C204
#> 162  14  16137231  17181838     3     1 A002C204
#> 163  14  17181839 106874228     1     1 A002C204
#> 164  15  17009590  17021518     1     1 A002C204
#> 165  15  17021519  17030497     3     0 A002C204
#> 166  15  17030498  22024845     2     1 A002C204
#> 167  15  22024846  57762495     1     1 A002C204
#> 168  15  57762496  57763216     3     0 A002C204
#> 169  15  57763217 101633478     1     1 A002C204
#> 170  16     46987  16414866     1     1 A002C204
#> 171  16  16414867  16700565     2     1 A002C204
#> 172  16  16700566  22504980     1     1 A002C204
#> 173  16  22504981  22699922     2     1 A002C204
#> 174  16  22699923  36277740     1     1 A002C204
#> 175  16  36277741  46428446     2     1 A002C204
#> 176  16  46428447  70046418     1     1 A002C204
#> 177  16  70046419  70229015     2     1 A002C204
#> 178  16  70229016  90051298     1     1 A002C204
#> 179  17    143015  12650427     1     1 A002C204
#> 180  17  12650428  12653101     4     4 A002C204
#> 181  17  12653102  21751028     1     1 A002C204
#> 182  17  21751029  21855518     2     1 A002C204
#> 183  17  21855519  21858186     2     0 A002C204
#> 184  17  21858187  22726028     1     1 A002C204
#> 185  17  22726029  26769088     2     1 A002C204
#> 186  17  26769089  26836150     2     0 A002C204
#> 187  17  26836151  83204151     1     1 A002C204
#> 188  18    132671  15195206     1     1 A002C204
#> 189  18  15195207  20874209     2     1 A002C204
#> 190  18  20874210  61969008     1     1 A002C204
#> 191  18  61969009  61971189     4     3 A002C204
#> 192  18  61971190  80248182     1     1 A002C204
#> 193  19    263280   1524112     2     1 A002C204
#> 194  19   1524113   1775290     3     2 A002C204
#> 195  19   1775291   8097458     2     1 A002C204
#> 196  19   8097459   8268512     3     2 A002C204
#> 197  19   8268513  24369446     2     1 A002C204
#> 198  19  24369447  24896730     3     1 A002C204
#> 199  19  24896731  24897864     3     0 A002C204
#> 200  19  24897865  27242278     3     1 A002C204
#> 201  19  27242279  27354712     2     1 A002C204
#> 202  19  27354713  27407438     3     1 A002C204
#> 203  19  27407439  58580561     2     1 A002C204
#> 204  20     61083  26331013     1     1 A002C204
#> 205  20  26331014  26345356     2     0 A002C204
#> 206  20  26345357  28784970     2     1 A002C204
#> 207  20  28784971  28826332     2     0 A002C204
#> 208  20  28826333  28886948     2     1 A002C204
#> 209  20  28886949  28904928     2     0 A002C204
#> 210  20  28904929  30064009     2     1 A002C204
#> 211  20  30064010  64281506     1     1 A002C204
#> 212  21   7324287   7325448     2     1 A002C204
#> 213  21   7325449   7325732     2     0 A002C204
#> 214  21   7325733   7326344     2     1 A002C204
#> 215  21   7326345   7919116     2     0 A002C204
#> 216  21   7919117   7925434     3     1 A002C204
#> 217  21   7925435   7954084     2     0 A002C204
#> 218  21   7954085  10701814     3     1 A002C204
#> 219  21  10701815  10702238     2     0 A002C204
#> 220  21  10702239  10705696     2     1 A002C204
#> 221  21  10705697  10705967     2     0 A002C204
#> 222  21  10705968  10758066     3     1 A002C204
#> 223  21  10758067  10758828     2     0 A002C204
#> 224  21  10758829  10784464     2     1 A002C204
#> 225  21  10784465  11889812     3     1 A002C204
#> 226  21  11889813  13493784     2     1 A002C204
#> 227  21  13493785  46672164     1     1 A002C204
#> 228  22  11219527  12401808     2     1 A002C204
#> 229  22  12401809  12402615     2     0 A002C204
#> 230  22  12402616  12423085     2     1 A002C204
#> 231  22  12423086  22584056     1     1 A002C204
#> 232  22  22584057  22587092     2     2 A002C204
#> 233  22  22587093  40151354     1     1 A002C204
#> 234  22  40151355  40171254     2     2 A002C204
#> 235  22  40171255  44414652     1     1 A002C204
#> 236  22  44414653  44449100     2     1 A002C204
#> 237  22  44449101  50736234     1     1 A002C204
data.frame(purity)
#>   Purity
#> 1  0.805
x = init(snvs,
         cna,
         purity,
         ref = "hg38")
#>  [ CNAqc - CNA Quality Check ]
#> ℹ Using reference genome coordinates for: hg38.
#> Warning in fortify_mutation_calls(snvs): You are using indels mutation data,
#> just beware that indels count-values aree less reliable than SNVs ones ....
#> ! Missing CCF column from CNA calls, adding CCF = 1 assuming clonal CNA calls.
#> ! Missing segments length from CNA calls, adding it to CNA calls.
#> ! CNA chromosomes should be in the format 'chr*', I will add a 'chr' prefix.
#> ℹ Input n = 154 mutations for 237 CNA segments (237 clonal, 0 subclonal)
#> ✓ Mapped n = 154 mutations to clonal segments (100% of input)

snvs.samp = x$snvs

cna.samp = x$cna

pure.samp = x$purity
ccf = compute_CCF(x)
#> ── Computing mutation multiplicity for karyotype 2:0 using the entropy method. ─
#> ℹ Expected Binomial peak(s) for these calls (1 and 2 copies):
#> Error in dbinom(NV, size = n, prob = p): Non-numeric argument to mathematical function
ccf.data = CCF(ccf)
#> Error in CCF(ccf): inherits(x, "cnaqc") is not TRUE
ccf.data$CCF[ccf.data$CCF>=1] = 1
#> Error in ccf.data$CCF[ccf.data$CCF >= 1] = 1: object 'ccf.data' not found
ccfs[[sample]] = ccf.data  
#> Error in eval(expr, envir, enclos): object 'ccf.data' not found

^{Created on 2020-11-17 by the reprex package (v0.3.0.9001)}

Thank you very much. Please let me know if you need any more details.

caravagn · 2020-11-17T22:28:53Z

The reprex is clear, thanks, and I should be able to fix it -- maybe is the fact that some mutations have 0 DP and 0 VAF and you get some NA somewhere? Btw, could you link here file "~/Desktop/cnaquestion.RData" so I can avoid copy-pasting from this shell and parsing the input?

caravagn · 2020-11-17T22:29:39Z

Sending it to [email protected] would work too - thanks.

ahorn720 · 2020-11-18T04:19:35Z

Though this shows up as a comment…this is an email to the email yoou posted below too with that linked file Thank you!

…

On Nov 17, 2020, at 2:29 PM, Giulio Caravagna ***@***.***> wrote: Sending it to ***@***.*** ***@***.***> would work too - thanks. — You are receiving this because you were mentioned. Reply to this email directly, view it on GitHub <#4 (comment)>, or unsubscribe <https://github.com/notifications/unsubscribe-auth/ABY3HY77S4WRUD7COBRGHI3SQL2OBANCNFSM4TQAQ5IQ>.

ahorn720 · 2020-11-18T04:21:56Z

From whaat I could tell it had to do with the Karyotype being 2:0 for this set of mutations. In this dataset, all the mutations are from a single gene which are from a single segment which inn this case is 2:0. But of course I’ll defer to your expertise on the software. Thats just what I could determine from my little investigation. I look forward to seeing what the issue was. I may have another issue in the future too but one thing at a time :)

…

On Nov 17, 2020, at 2:29 PM, Giulio Caravagna ***@***.***> wrote: The reprex is clear, thanks, and I should be able to fix it -- maybe is the fact that some mutations have 0 DP and 0 VAF and you get some NA somewhere? Btw, could you link here file "~/Desktop/cnaquestion.RData" so I can avoid copy-pasting from this shell and parsing the input? — You are receiving this because you were mentioned. Reply to this email directly, view it on GitHub <#4 (comment)>, or unsubscribe <https://github.com/notifications/unsubscribe-auth/ABY3HY7G7MOSSVQRX26NI7DSQL2LHANCNFSM4TQAQ5IQ>.

caravagn · 2020-11-19T21:41:22Z

Hey, I've fixed it. There was a problem for a weird case I did not consider. Now it works and computes CCF for your data. Thanks (PS I did improve some other visualisations etc.)

caravagn · 2020-11-19T21:42:10Z

See [4a1d37f]

luca-dex assigned caravagn Nov 17, 2020

caravagn added the bug Something isn't working label Nov 17, 2020

caravagn closed this as completed Nov 19, 2020

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Non-numeric argument to mathematical function dbinom #4

Non-numeric argument to mathematical function dbinom #4

ahorn720 commented Nov 10, 2020

ahorn720 commented Nov 10, 2020

ahorn720 commented Nov 17, 2020

luca-dex commented Nov 17, 2020

caravagn commented Nov 17, 2020

caravagn commented Nov 17, 2020

caravagn commented Nov 17, 2020

ahorn720 commented Nov 17, 2020

caravagn commented Nov 17, 2020

caravagn commented Nov 17, 2020

ahorn720 commented Nov 18, 2020 via email

ahorn720 commented Nov 18, 2020 via email

caravagn commented Nov 19, 2020

caravagn commented Nov 19, 2020

Non-numeric argument to mathematical function dbinom #4

Non-numeric argument to mathematical function dbinom #4

Comments

ahorn720 commented Nov 10, 2020

ahorn720 commented Nov 10, 2020

ahorn720 commented Nov 17, 2020

luca-dex commented Nov 17, 2020

caravagn commented Nov 17, 2020

caravagn commented Nov 17, 2020

caravagn commented Nov 17, 2020

ahorn720 commented Nov 17, 2020

caravagn commented Nov 17, 2020

caravagn commented Nov 17, 2020

ahorn720 commented Nov 18, 2020 via email

ahorn720 commented Nov 18, 2020 via email

caravagn commented Nov 19, 2020

caravagn commented Nov 19, 2020