combo_biome-revived.ipynb

{
 "cells": [
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "# One big biome table"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Since I am hoping to make comparisons of wood and leaf endophyte environmental patterns, I need to combine these datasets early in the biomformatics pipeline, to make them as comparable as possible. We'll try to stick to the [usearch (uparse)](http://drive5.com/usearch/) pipeline for the process, as much as possible.\n",
    "\n",
    "------------\n",
    "\n",
    "That was a year ago. \n",
    "\n",
    "Since then my car has been stolen, with my laptop in it. And the manuscripts which are based on these scripts are submitted. Somehow, the versions of this notebook and the following analysis notebook that were on github lost most of its graphic outputs, charts and maps and stuff. While most of the important graphics, etc, were backed up, I lost some of the computationally expensive intermediate files necessary to repopulate. \n",
    "\n",
    "So to make this notebook useable to reviewers and readers, I'll be picking through this process again, and the downstream analysis, if I don't go insane in the meantime. Maybe even if I do."
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Table of contents\n",
    "\n",
    "[Work environment](#environment)  \n",
    "[Rearranging barcodes](#rearrange)  \n",
    "[Trimming reads](#trim)  \n",
    "[Merging paired-end reads](#mergepairs) \n",
    "- [Leaf reads](#mergeLeaf)\n",
    "- [Wood reads](#mergeWood)\n",
    "\n",
    "[Visualizing merged read qualities](#visMerge)  \n",
    "- [Make quality score charts](#makeQcharts)  \n",
    "- [Leaf read qualities](#leafReadScores)\n",
    "- [Wood read qualities](#woodReadScores)\n",
    "\n",
    "[Quality filtering reads](#qf)  \n",
    "[Convert fastq files to fasta format](#fastq2fasta)  \n",
    "[Demultiplex leaf reads](#demult)  \n",
    "[Clip primers](#clipPrimers)  \n",
    "[Checking for chimeras](#chimeras)  \n",
    "[Finding ITS1 region](#ITSx)  \n",
    "\n",
    "[OTU clustering](#OTUclust)  \n",
    "- [Dereplication and Sorting of reads](#derep)  \n",
    "- [Cluster reads](#Cluster)\n",
    "- [Assign unique names to OTU clusters](#addOTUtag)\n",
    "- [Assign taxonomy](#assTax)\n",
    "- [Make biom table](#makeBiom)\n",
    "\n",
    "\n",
    "[Formatting Biom table and adding metadata](#formBiom)  \n",
    "- [Change biom taxonomy metadata format](#formTax)\n",
    "- [Add sample metadata](#addMetadata)\n",
    "\n",
    "\n"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id='environment'><h3>Work environment</h3></a>"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Working directory, on my machine:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 2,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": []
    }
   ],
   "source": [
    "cd /home/daniel/Documents/Taiwan_data/combined/combo_biome"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "We'll be using the [usearch (uparse)](http://drive5.com/usearch/) pipeline, version v8.0.1623_i86linux32, on the University of Oregon's Talapas computing cluster."
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id='rearrange'><h3>Rearranging barcodes</h3></a>"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "We need to merged paired end sequences of the leaves and wood. But before we can do this, there are several steps. First, the leaf study reads include a split 6+6 bp barcode scheme for identifying reads, so these need to be clipped from one read and combined on the other. I wrote a python script for this:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 4,
   "metadata": {
    "scrolled": true
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "#!/usr/bin/env python3\n",
      "\n",
      "## lets try to take a two unpaired read files, cut out the bp from the reverse,\n",
      "## and tack it onto the forward.\n",
      "## have to preserve the fastq format so that pandaseq can do unsplit3.py forward_reads reverse_reads\n",
      "\n",
      "#The first six bps and quality ratings of the reverse reads should be chopped off and placed after\n",
      "#the first six bps of the forward reads and quality ratings. For use with fastq files. It will spit\n",
      "#out two files, with the names: \"rearranged_[your orignial forward and reverse read file names].fastq\".\n",
      "\n",
      "import itertools ##to let us jump around \n",
      "from sys import argv\n",
      "\n",
      "script, forward_file, reverse_file = argv\n",
      "\n",
      "forwardlabels=[]\n",
      "reverselabels=[]\n",
      "forwardreads=[]\n",
      "forwardreadsq=[]\n",
      "reversereads=[]\n",
      "reversereadsq=[]\n",
      "forwardBC=[]\n",
      "forwardBCq=[]\n",
      "reverseBC=[]\n",
      "reverseBCq=[]\n",
      "\n",
      "with open(forward_file) as foop:\n",
      "\n",
      "\t#labels:\n",
      "\n",
      "\tfor h in itertools.islice(foop, 0, None, 4):\n",
      "\t\tforwardlabels.append(h)\n",
      "\n",
      "##forward sequencies, barcodes: \n",
      "\n",
      "\tfoop.seek(0)\n",
      "    \n",
      "\tfor i in itertools.islice(foop, 1, None, 4):\n",
      "\t\tforwardreads.append(i[6:])        \n",
      "\t\tforwardBC.append(i[0:6])\n",
      "\n",
      "##forward quality info:\n",
      "\n",
      "\tfoop.seek(0)\n",
      "\n",
      "\tfor j in itertools.islice(foop, 3, None, 4):\n",
      "\t\tforwardreadsq.append(j[6:])\n",
      "\t\tforwardBCq.append(j[0:6])\n",
      "\n",
      "## reverse reads and sequences:\n",
      "\n",
      "with open(reverse_file) as coop:\n",
      "\n",
      "#labels:\n",
      "\n",
      "\tfor h in itertools.islice(coop, 0, None, 4):\n",
      "\t\treverselabels.append(h)\n",
      "\n",
      "##Reverse reads and sequences: \n",
      "\n",
      "\tcoop.seek(0)\n",
      "    \n",
      "   \n",
      "\tfor i in itertools.islice(coop, 1, None, 4):\n",
      "\t\treversereads.append(i[6:])        \n",
      "\t\treverseBC.append(i[0:6])\n",
      "\n",
      "## reverse quality info\n",
      "\n",
      "\tcoop.seek(0)\n",
      "\n",
      "\tfor j in itertools.islice(coop, 3, None, 4): \n",
      "\t\treversereadsq.append(j[6:])\n",
      "\t\treverseBCq.append(j[0:6])\n",
      "\n",
      "##do I need the reverse compliment on these? Don't think so, guess I'll find out. \n",
      "##Now, to combine into a new fastq file\n",
      "\n",
      "ee=['rearranged_', forward_file]\n",
      "ff=''.join(ee)\n",
      "\n",
      "with open(ff,'w') as foop2:\n",
      "\n",
      "\tfor j in range(len(forwardreads)):\n",
      "\t\t    \n",
      "\t\tprint(forwardlabels[j], file = foop2, end = '')\n",
      "\t\tprint(forwardBC[j]+reverseBC[j]+forwardreads[j], sep = '', file = foop2, end='') \n",
      "\t\tprint('+', file = foop2)\n",
      "\t\tprint(forwardBCq[j]+reverseBCq[j]+forwardreadsq[j], file = foop2, end = '')\n",
      "\n",
      "gg=['rearranged_', reverse_file]\n",
      "hh=''.join(gg)\n",
      "\n",
      "with open(hh,'w') as goop2:\n",
      "\n",
      "\tfor j in range(len(reversereads)):\n",
      "\t    \n",
      "\t\tprint(reverselabels[j], file = goop2, end = '')\n",
      "        ## this line is edited to keep barcodes in reverse reads:\n",
      "\t\tprint(forwardBC[j]+reverseBC[j]+reversereads[j], file = goop2, end='')\n",
      "\t\tprint('+', file = goop2)\n",
      "\t\t#print(reversereadsq[j], file = goop2, end = '')\n",
      "        ## this line above replaced with line below, also \n",
      "        ## to keep barcodes in reverse reads:\n",
      "\t\tprint(forwardBCq[j]+reverseBCq[j]+reversereadsq[j], file = goop2, end = '')\n",
      "\n",
      "\n",
      "\n",
      "\n",
      "\n",
      "\n",
      "\n",
      "\n",
      "\n",
      "##a function for reverse complimenting (may need this?):\n",
      "\n",
      "#def revcompl(x): \n",
      "\n",
      "#    aa=''.join([{'A':'T','C':'G','G':'C','T':'A'}[B] for B in x][::-1])\n",
      "#    return(aa)\n",
      " \n"
     ]
    }
   ],
   "source": [
    "cat scripts/BCunsplit.py"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "I have details on how I used this [here](https://github.com/danchurch/taiwan_dada2/blob/master/dada2pipeline.ipynb). \n",
    "\n",
    "This outputs two files, \"rearranged_Roo_R2.fastq\" and \"rearranged_Roo_R2.fastq\". I did this in another directory, so we'll add some sym links here for convenience:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 8,
   "metadata": {},
   "outputs": [],
   "source": [
    "## leaves\n",
    "ln -s /home/daniel/Documents/taiwan/taiwan_dada2/rearranged_leafR1.fastq reLeafR1.fastq\n",
    "ln -s /home/daniel/Documents/taiwan/taiwan_dada2/rearranged_leafR2.fastq reLeafR2.fastq"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id='trim'><h3>Trimming reads</h3></a>"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Next we trim a little to make sure we doing our alignments with high quality base calls. The sites for trimming are decided by looking at the raw reads [(see below)](#quality), and finding where quality begins to drop off. \n",
    "To trim, we'll use the [FASTX-toolkit](http://hannonlab.cshl.edu/fastx_toolkit/)."
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Our wood reads are already demultiplexed, so we don't have a single forward and reverse read file for all of our wood samples, like we do above with the leaves. So let's make a script for this:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "## trims.sh\n",
    "#####################################################\n",
    "\n",
    "\n",
    "## wood reads live here:\n",
    "wooddir=/home/daniel/Documents/taiwan/woodreads/\n",
    "\n",
    "## working directory is here:\n",
    "cd /home/daniel/Documents/taiwan/taiwan_combined_biom\n",
    "\n",
    "###### R1 reads:\n",
    "\n",
    "## home for trimmed R1 wood reads here:\n",
    "R1trimdir='/home/daniel/Documents/taiwan/taiwan_combined_biom/trimmed_wood/R1/'\n",
    "\n",
    "## trim just the R1s, output to their new home with new filename:\n",
    "for i in $wooddir*_R1_*; do\n",
    "    echo $i\n",
    "    out=$R1trimdir$(basename ${i/_001\\.fastq/_trimmed\\.fastq})\n",
    "    fastx_trimmer -l 255 -i $i -o $out && echo $out \n",
    "done\n",
    "\n",
    "###### R2 reads:\n",
    "\n",
    "## home for trimmed R2 wood reads here:\n",
    "R2trimdir='/home/daniel/Documents/taiwan/taiwan_combined_biom/trimmed_wood/R2/'\n",
    "\n",
    "## trim just the R2s, output to their new home with new filename:\n",
    "for j in $wooddir*_R2_*; do\n",
    "    echo $j\n",
    "    out=$R2trimdir$(basename ${j/_001\\.fastq/_trimmed\\.fastq})\n",
    "    fastx_trimmer -l 210 -i $j -o $out && echo $out \n",
    "done"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 2,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": []
    }
   ],
   "source": [
    "## leaves. These lengths were decided by Roo. They are all still in one pile:\n",
    "fastx_trimmer -l 263 -i reLeafR1.fastq -o Roo_R1_trimmed.fastq\n",
    "fastx_trimmer -l 170 -i reLeafR2.fastq -o Roo_R2_trimmed.fastq"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id='mergepairs'><h3>Merging paired-end reads</h3></a> "
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Unfortunately, I no longer have access to the 64-bit version of usearch 8.1. So let's use the 32-bit version:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 7,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (8.0Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n"
     ]
    }
   ],
   "source": [
    "usearch"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id='mergeLeaf'><h4>Leaf reads</h4></a>"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "The leaf files are too large to be handled by the 32-version. We don't want to demultiplex yet, this will be messy with the split barcodes. So let's break up the leaf files into smaller ones and merge these."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "cd /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves\n",
    "\n",
    "for i in Roo_R*_*; do\n",
    "    ls $i\n",
    "    split -d -l 500000 $i ${i/fastq/split\\.fastq}\n",
    "done"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Makes a lot of files:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 10,
   "metadata": {
    "scrolled": true
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "aln_3.txt\n",
      "leafSplitLs.txt\n",
      "Roo_R1_trimmed.split.fastq00\n",
      "Roo_R1_trimmed.split.fastq01\n",
      "Roo_R1_trimmed.split.fastq02\n",
      "Roo_R1_trimmed.split.fastq03\n",
      "Roo_R1_trimmed.split.fastq04\n",
      "Roo_R1_trimmed.split.fastq05\n",
      "Roo_R1_trimmed.split.fastq06\n",
      "Roo_R1_trimmed.split.fastq07\n",
      "Roo_R1_trimmed.split.fastq08\n",
      "Roo_R1_trimmed.split.fastq09\n",
      "Roo_R1_trimmed.split.fastq10\n",
      "Roo_R1_trimmed.split.fastq11\n",
      "Roo_R1_trimmed.split.fastq12\n",
      "Roo_R1_trimmed.split.fastq13\n",
      "Roo_R1_trimmed.split.fastq14\n",
      "Roo_R1_trimmed.split.fastq15\n",
      "Roo_R1_trimmed.split.fastq16\n",
      "Roo_R1_trimmed.split.fastq17\n",
      "Roo_R1_trimmed.split.fastq18\n",
      "Roo_R1_trimmed.split.fastq19\n",
      "Roo_R1_trimmed.split.fastq20\n",
      "Roo_R1_trimmed.split.fastq21\n",
      "Roo_R1_trimmed.split.fastq22\n",
      "Roo_R1_trimmed.split.fastq23\n",
      "Roo_R1_trimmed.split.fastq24\n",
      "Roo_R1_trimmed.split.fastq25\n",
      "Roo_R1_trimmed.split.fastq26\n",
      "Roo_R1_trimmed.split.fastq27\n",
      "Roo_R1_trimmed.split.fastq28\n",
      "Roo_R1_trimmed.split.fastq29\n",
      "Roo_R1_trimmed.split.fastq30\n",
      "Roo_R1_trimmed.split.fastq31\n",
      "Roo_R1_trimmed.split.fastq32\n",
      "Roo_R1_trimmed.split.fastq33\n",
      "Roo_R1_trimmed.split.fastq34\n",
      "Roo_R1_trimmed.split.fastq35\n",
      "Roo_R1_trimmed.split.fastq36\n",
      "Roo_R1_trimmed.split.fastq37\n",
      "Roo_R1_trimmed.split.fastq38\n",
      "Roo_R1_trimmed.split.fastq39\n",
      "Roo_R1_trimmed.split.fastq40\n",
      "Roo_R1_trimmed.split.fastq41\n",
      "Roo_R1_trimmed.split.fastq42\n",
      "Roo_R1_trimmed.split.fastq43\n",
      "Roo_R1_trimmed.split.fastq44\n",
      "Roo_R1_trimmed.split.fastq45\n",
      "Roo_R1_trimmed.split.fastq46\n",
      "Roo_R1_trimmed.split.fastq47\n",
      "Roo_R1_trimmed.split.fastq48\n",
      "Roo_R1_trimmed.split.fastq49\n",
      "Roo_R1_trimmed.split.fastq50\n",
      "Roo_R1_trimmed.split.fastq51\n",
      "Roo_R1_trimmed.split.fastq52\n",
      "Roo_R1_trimmed.split.fastq53\n",
      "Roo_R1_trimmed.split.fastq54\n",
      "Roo_R1_trimmed.split.fastq55\n",
      "Roo_R1_trimmed.split.fastq56\n",
      "Roo_R1_trimmed.split.fastq57\n",
      "Roo_R1_trimmed.split.fastq58\n",
      "Roo_R1_trimmed.split.fastq59\n",
      "Roo_R1_trimmed.split.fastq60\n",
      "Roo_R1_trimmed.split.fastq61\n",
      "Roo_R1_trimmed.split.fastq62\n",
      "Roo_R1_trimmed.split.fastq63\n",
      "Roo_R1_trimmed.split.fastq64\n",
      "Roo_R1_trimmed.split.fastq65\n",
      "Roo_R1_trimmed.split.fastq66\n",
      "Roo_R1_trimmed.split.fastq67\n",
      "Roo_R1_trimmed.split.fastq68\n",
      "Roo_R1_trimmed.split.fastq69\n",
      "Roo_R1_trimmed.split.fastq70\n",
      "Roo_R1_trimmed.split.fastq71\n",
      "Roo_R1_trimmed.split.fastq72\n",
      "Roo_R1_trimmed.split.fastq73\n",
      "Roo_R1_trimmed.split.fastq74\n",
      "Roo_R1_trimmed.split.fastq75\n",
      "Roo_R1_trimmed.split.fastq76\n",
      "Roo_R1_trimmed.split.fastq77\n",
      "Roo_R1_trimmed.split.fastq78\n",
      "Roo_R1_trimmed.split.fastq79\n",
      "Roo_R1_trimmed.split.fastq80\n",
      "Roo_R1_trimmed.split.fastq81\n",
      "Roo_R1_trimmed.split.fastq82\n",
      "Roo_R1_trimmed.split.fastq83\n",
      "Roo_R1_trimmed.split.fastq84\n",
      "Roo_R1_trimmed.split.fastq85\n",
      "Roo_R1_trimmed.split.fastq86\n",
      "Roo_R1_trimmed.split.fastq87\n",
      "Roo_R1_trimmed.split.fastq88\n",
      "Roo_R1_trimmed.split.fastq89\n",
      "Roo_R1_trimmed.split.fastq9000\n",
      "Roo_R1_trimmed.split.fastq9001\n",
      "Roo_R1_trimmed.split.fastq9002\n",
      "Roo_R1_trimmed.split.fastq9003\n",
      "Roo_R1_trimmed.split.fastq9004\n",
      "Roo_R1_trimmed.split.fastq9005\n",
      "Roo_R1_trimmed.split.fastq9006\n",
      "Roo_R1_trimmed.split.fastq9007\n",
      "Roo_R1_trimmed.split.fastq9008\n",
      "Roo_R1_trimmed.split.fastq9009\n",
      "Roo_R1_trimmed.split.fastq9010\n",
      "Roo_R1_trimmed.split.fastq9011\n",
      "Roo_R1_trimmed.split.fastq9012\n",
      "Roo_R1_trimmed.split.fastq9013\n",
      "Roo_R1_trimmed.split.fastq9014\n",
      "Roo_R1_trimmed.split.fastq9015\n",
      "Roo_R1_trimmed.split.fastq9016\n",
      "Roo_R1_trimmed.split.fastq9017\n",
      "Roo_R1_trimmed.split.fastq9018\n",
      "Roo_R1_trimmed.split.fastq9019\n",
      "Roo_R1_trimmed.split.fastq9020\n",
      "Roo_R1_trimmed.split.fastq9021\n",
      "Roo_R1_trimmed.split.fastq9022\n",
      "Roo_R1_trimmed.split.fastq9023\n",
      "Roo_R1_trimmed.split.fastq9024\n",
      "Roo_R1_trimmed.split.fastq9025\n",
      "Roo_R1_trimmed.split.fastq9026\n",
      "Roo_R1_trimmed.split.fastq9027\n",
      "Roo_R1_trimmed.split.fastq9028\n",
      "Roo_R1_trimmed.split.fastq9029\n",
      "Roo_R1_trimmed.split.fastq9030\n",
      "Roo_R1_trimmed.split.fastq9031\n",
      "Roo_R1_trimmed.split.fastq9032\n",
      "Roo_R1_trimmed.split.fastq9033\n",
      "Roo_R1_trimmed.split.fastq9034\n",
      "Roo_R1_trimmed.split.fastq9035\n",
      "Roo_R1_trimmed.split.fastq9036\n",
      "Roo_R1_trimmed.split.fastq9037\n",
      "Roo_R1_trimmed.split.fastq9038\n",
      "Roo_R1_trimmed.split.fastq9039\n",
      "Roo_R1_trimmed.split.fastq9040\n",
      "Roo_R1_trimmed.split.fastq9041\n",
      "Roo_R1_trimmed.split.fastq9042\n",
      "Roo_R1_trimmed.split.fastq9043\n",
      "Roo_R1_trimmed.split.fastq9044\n",
      "Roo_R1_trimmed.split.fastq9045\n",
      "Roo_R1_trimmed.split.fastq9046\n",
      "Roo_R1_trimmed.split.fastq9047\n",
      "Roo_R1_trimmed.split.fastq9048\n",
      "Roo_R1_trimmed.split.fastq9049\n",
      "Roo_R1_trimmed.split.fastq9050\n",
      "Roo_R1_trimmed.split.fastq9051\n",
      "Roo_R1_trimmed.split.fastq9052\n",
      "Roo_R1_trimmed.split.fastq9053\n",
      "Roo_R1_trimmed.split.fastq9054\n",
      "Roo_R1_trimmed.split.fastq9055\n",
      "Roo_R2_trimmed.split.fastq00\n",
      "Roo_R2_trimmed.split.fastq01\n",
      "Roo_R2_trimmed.split.fastq02\n",
      "Roo_R2_trimmed.split.fastq03\n",
      "Roo_R2_trimmed.split.fastq04\n",
      "Roo_R2_trimmed.split.fastq05\n",
      "Roo_R2_trimmed.split.fastq06\n",
      "Roo_R2_trimmed.split.fastq07\n",
      "Roo_R2_trimmed.split.fastq08\n",
      "Roo_R2_trimmed.split.fastq09\n",
      "Roo_R2_trimmed.split.fastq10\n",
      "Roo_R2_trimmed.split.fastq11\n",
      "Roo_R2_trimmed.split.fastq12\n",
      "Roo_R2_trimmed.split.fastq13\n",
      "Roo_R2_trimmed.split.fastq14\n",
      "Roo_R2_trimmed.split.fastq15\n",
      "Roo_R2_trimmed.split.fastq16\n",
      "Roo_R2_trimmed.split.fastq17\n",
      "Roo_R2_trimmed.split.fastq18\n",
      "Roo_R2_trimmed.split.fastq19\n",
      "Roo_R2_trimmed.split.fastq20\n",
      "Roo_R2_trimmed.split.fastq21\n",
      "Roo_R2_trimmed.split.fastq22\n",
      "Roo_R2_trimmed.split.fastq23\n",
      "Roo_R2_trimmed.split.fastq24\n",
      "Roo_R2_trimmed.split.fastq25\n",
      "Roo_R2_trimmed.split.fastq26\n",
      "Roo_R2_trimmed.split.fastq27\n",
      "Roo_R2_trimmed.split.fastq28\n",
      "Roo_R2_trimmed.split.fastq29\n",
      "Roo_R2_trimmed.split.fastq30\n",
      "Roo_R2_trimmed.split.fastq31\n",
      "Roo_R2_trimmed.split.fastq32\n",
      "Roo_R2_trimmed.split.fastq33\n",
      "Roo_R2_trimmed.split.fastq34\n",
      "Roo_R2_trimmed.split.fastq35\n",
      "Roo_R2_trimmed.split.fastq36\n",
      "Roo_R2_trimmed.split.fastq37\n",
      "Roo_R2_trimmed.split.fastq38\n",
      "Roo_R2_trimmed.split.fastq39\n",
      "Roo_R2_trimmed.split.fastq40\n",
      "Roo_R2_trimmed.split.fastq41\n",
      "Roo_R2_trimmed.split.fastq42\n",
      "Roo_R2_trimmed.split.fastq43\n",
      "Roo_R2_trimmed.split.fastq44\n",
      "Roo_R2_trimmed.split.fastq45\n",
      "Roo_R2_trimmed.split.fastq46\n",
      "Roo_R2_trimmed.split.fastq47\n",
      "Roo_R2_trimmed.split.fastq48\n",
      "Roo_R2_trimmed.split.fastq49\n",
      "Roo_R2_trimmed.split.fastq50\n",
      "Roo_R2_trimmed.split.fastq51\n",
      "Roo_R2_trimmed.split.fastq52\n",
      "Roo_R2_trimmed.split.fastq53\n",
      "Roo_R2_trimmed.split.fastq54\n",
      "Roo_R2_trimmed.split.fastq55\n",
      "Roo_R2_trimmed.split.fastq56\n",
      "Roo_R2_trimmed.split.fastq57\n",
      "Roo_R2_trimmed.split.fastq58\n",
      "Roo_R2_trimmed.split.fastq59\n",
      "Roo_R2_trimmed.split.fastq60\n",
      "Roo_R2_trimmed.split.fastq61\n",
      "Roo_R2_trimmed.split.fastq62\n",
      "Roo_R2_trimmed.split.fastq63\n",
      "Roo_R2_trimmed.split.fastq64\n",
      "Roo_R2_trimmed.split.fastq65\n",
      "Roo_R2_trimmed.split.fastq66\n",
      "Roo_R2_trimmed.split.fastq67\n",
      "Roo_R2_trimmed.split.fastq68\n",
      "Roo_R2_trimmed.split.fastq69\n",
      "Roo_R2_trimmed.split.fastq70\n",
      "Roo_R2_trimmed.split.fastq71\n",
      "Roo_R2_trimmed.split.fastq72\n",
      "Roo_R2_trimmed.split.fastq73\n",
      "Roo_R2_trimmed.split.fastq74\n",
      "Roo_R2_trimmed.split.fastq75\n",
      "Roo_R2_trimmed.split.fastq76\n",
      "Roo_R2_trimmed.split.fastq77\n",
      "Roo_R2_trimmed.split.fastq78\n",
      "Roo_R2_trimmed.split.fastq79\n",
      "Roo_R2_trimmed.split.fastq80\n",
      "Roo_R2_trimmed.split.fastq81\n",
      "Roo_R2_trimmed.split.fastq82\n",
      "Roo_R2_trimmed.split.fastq83\n",
      "Roo_R2_trimmed.split.fastq84\n",
      "Roo_R2_trimmed.split.fastq85\n",
      "Roo_R2_trimmed.split.fastq86\n",
      "Roo_R2_trimmed.split.fastq87\n",
      "Roo_R2_trimmed.split.fastq88\n",
      "Roo_R2_trimmed.split.fastq89\n",
      "Roo_R2_trimmed.split.fastq9000\n",
      "Roo_R2_trimmed.split.fastq9001\n",
      "Roo_R2_trimmed.split.fastq9002\n",
      "Roo_R2_trimmed.split.fastq9003\n",
      "Roo_R2_trimmed.split.fastq9004\n",
      "Roo_R2_trimmed.split.fastq9005\n",
      "Roo_R2_trimmed.split.fastq9006\n",
      "Roo_R2_trimmed.split.fastq9007\n",
      "Roo_R2_trimmed.split.fastq9008\n",
      "Roo_R2_trimmed.split.fastq9009\n",
      "Roo_R2_trimmed.split.fastq9010\n",
      "Roo_R2_trimmed.split.fastq9011\n",
      "Roo_R2_trimmed.split.fastq9012\n",
      "Roo_R2_trimmed.split.fastq9013\n",
      "Roo_R2_trimmed.split.fastq9014\n",
      "Roo_R2_trimmed.split.fastq9015\n",
      "Roo_R2_trimmed.split.fastq9016\n",
      "Roo_R2_trimmed.split.fastq9017\n",
      "Roo_R2_trimmed.split.fastq9018\n",
      "Roo_R2_trimmed.split.fastq9019\n",
      "Roo_R2_trimmed.split.fastq9020\n",
      "Roo_R2_trimmed.split.fastq9021\n",
      "Roo_R2_trimmed.split.fastq9022\n",
      "Roo_R2_trimmed.split.fastq9023\n",
      "Roo_R2_trimmed.split.fastq9024\n",
      "Roo_R2_trimmed.split.fastq9025\n",
      "Roo_R2_trimmed.split.fastq9026\n",
      "Roo_R2_trimmed.split.fastq9027\n",
      "Roo_R2_trimmed.split.fastq9028\n",
      "Roo_R2_trimmed.split.fastq9029\n",
      "Roo_R2_trimmed.split.fastq9030\n",
      "Roo_R2_trimmed.split.fastq9031\n",
      "Roo_R2_trimmed.split.fastq9032\n",
      "Roo_R2_trimmed.split.fastq9033\n",
      "Roo_R2_trimmed.split.fastq9034\n",
      "Roo_R2_trimmed.split.fastq9035\n",
      "Roo_R2_trimmed.split.fastq9036\n",
      "Roo_R2_trimmed.split.fastq9037\n",
      "Roo_R2_trimmed.split.fastq9038\n",
      "Roo_R2_trimmed.split.fastq9039\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Roo_R2_trimmed.split.fastq9040\n",
      "Roo_R2_trimmed.split.fastq9041\n",
      "Roo_R2_trimmed.split.fastq9042\n",
      "Roo_R2_trimmed.split.fastq9043\n",
      "Roo_R2_trimmed.split.fastq9044\n",
      "Roo_R2_trimmed.split.fastq9045\n",
      "Roo_R2_trimmed.split.fastq9046\n",
      "Roo_R2_trimmed.split.fastq9047\n",
      "Roo_R2_trimmed.split.fastq9048\n",
      "Roo_R2_trimmed.split.fastq9049\n",
      "Roo_R2_trimmed.split.fastq9050\n",
      "Roo_R2_trimmed.split.fastq9051\n",
      "Roo_R2_trimmed.split.fastq9052\n",
      "Roo_R2_trimmed.split.fastq9053\n",
      "Roo_R2_trimmed.split.fastq9054\n",
      "Roo_R2_trimmed.split.fastq9055\n"
     ]
    }
   ],
   "source": [
    "cat leafSplitLs.txt"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Merge these:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "for forward in *_R1_*; do\n",
    "    #ls $forward\n",
    "    reverse=${forward/_R1_/_R2_}\n",
    "    usearch -fastq_mergepairs $forward \\\n",
    "        -reverse $reverse \\\n",
    "        -fastq_maxdiffpct 40 \\\n",
    "        -alnout aln_3.txt \\ ## oops, fix this if reused\n",
    "        -report ../reports/$forward.report.txt \\\n",
    "        -fastqout ../merged/$forward.merged.fastq\n",
    "    #ls $reverse\n",
    "done"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "And put them back together."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "cd /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/merged\n",
    "\n",
    "cat * > leaf_trimmed_merged.fastq"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id='mergeWood'><h4>Wood reads</h4></a>"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "We don't have the same issue on the wood, because they are already demultiplexed, and the 32-bit version of usearch can handle these smaller files fine:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "for forward in *fastq; do\n",
    "    ls -l $forward\n",
    "    reverse=\"../R2/${forward/R1/R2}\"\n",
    "    usearch -fastq_mergepairs $forward \\\n",
    "        -reverse $reverse \\\n",
    "        -fastq_maxdiffpct 40 \\\n",
    "        -alnout aln_3.txt \\ ## oops, fix this if reused\n",
    "        -report ../reports/$forward.report.txt \\\n",
    "        -fastqout ./$forward.merged.fastq\n",
    "    echo $reverse\n",
    "done"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id='visMerge'><h3>Visualizing merged read qualities</h3></a>"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id='makeQcharts'><h4>Make quality score charts</h4></a>  \n",
    "Let's make some charts of our read quality, using fastx tools. First, compile the stats on each basepair:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "#!/usr/bin/env bash\n",
    "\n",
    "## leaf reads\n",
    "\n",
    "cd /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/qCharts/leaf\n",
    "\n",
    "rawLeafReadsR1=\"/home/daniel/Documents/taiwan_supp/roo_reads/TaiwanFA_R1.fastq\"\n",
    "rawLeafReadsR2=\"/home/daniel/Documents/taiwan_supp/roo_reads/TaiwanFA_R2.fastq\"\n",
    "trimmedLeafReadsR1=\"/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/Roo_R1_trimmed.fastq\"\n",
    "trimmedLeafReadsR2=\"/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/Roo_R2_trimmed.fastq\"\n",
    "leafmerg=\"/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/merged/leaf_trimmed_merged.fastq\"\n",
    "\n",
    "## leaf quality stats:\n",
    "fastx_quality_stats -i $rawLeafReadsR1 -o rawLeafReadsR1_fastxstats.txt\n",
    "fastx_quality_stats -i $rawLeafReadsR2 -o rawLeafReadsR2_fastxstats.txt\n",
    "fastx_quality_stats -i $trimmedLeafReadsR1 -o trimmedLeafReadsR1_fastxstats.txt\n",
    "fastx_quality_stats -i $trimmedLeafReadsR2 -o trimmedLeafReadsR2_fastxstats.txt\n",
    "fastx_quality_stats -i $leafmerg -o leafmerged_fastxstats.txt"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "For the wood, to visualize them as a whole, we'll combine reads of the steps we've done so far:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "cat /home/daniel/Documents/taiwan_supp/wood_reads/*R1* > /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/rawWoodReadsR1.fastq\n",
    "\n",
    "cat /home/daniel/Documents/taiwan_supp/wood_reads/*R2* > /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/rawWoodReadsR2.fastq\n",
    "\n",
    "cat /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/R1/* > /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmedWoodR1.fastq\n",
    "\n",
    "cat /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/R2/* > /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmedWoodR2.fastq\n",
    "\n",
    "cat /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/merged/* > /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/woodMerged.fastq\n"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Compile the stats for these combined wood files:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "#!/usr/bin/env bash\n",
    "\n",
    "cd /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom\n",
    "\n",
    "fastx_quality_stats -i rawWoodReadsR1.fastq -o qCharts/wood/rawWoodReadsR1_fastxstats.txt\n",
    "fastx_quality_stats -i rawWoodReadsR2.fastq -o qCharts/wood/rawWoodReadsR2_fastxstats.txt\n",
    "fastx_quality_stats -i trimmedWoodR1.fastq -o qCharts/wood/trimmedWoodR1_fastxstats.txt\n",
    "fastx_quality_stats -i trimmedWoodR2.fastq -o qCharts/wood/trimmedWoodR2_fastxstats.txt\n",
    "fastx_quality_stats -i woodMerged.fastq -o qCharts/wood/woodMerged_fastxstats.txt"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Then make the actual graphics."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "cd /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/qCharts\n",
    "\n",
    "cd leaf\n",
    "\n",
    "for i in *; do\n",
    "    ../dan_fastx_plot.sh -i $i -o ${i/\\.txt/\\.png}\n",
    "done\n",
    "\n",
    "cd ../wood\n",
    "\n",
    "for i in *; do\n",
    "    ../dan_fastx_plot.sh -i $i -o ${i/\\.txt/\\.png}\n",
    "done"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id='leafReadScores'><h4>Leaf read qualities</h4></a>"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Forward raw reads:\n",
    "\n",
    "![](rawLeafReadsR2_fastxstats.png)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Reverse raw Leaf reads.\n",
    "![](rawLeafReadsR1_fastxstats.png)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Forward trimmed Leaf reads.\n",
    "![](trimmedLeafReadsR2_fastxstats.png)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Reverse trimmed Leaf reads.\n",
    "![](trimmedLeafReadsR1_fastxstats.png)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "And the merged leaf reads.\n",
    "![](leafmerged_fastxstats.png)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id='woodReadScores'><h4>Wood read qualities</h4></a>"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Wood raw forward reads:\n",
    "![](rawWoodReadsR1_fastxstats.png)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Wood raw reverse reads:\n",
    "![](rawWoodReadsR2_fastxstats.png)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Wood trimmed forward reads:\n",
    "![](rawWoodReadsR1_fastxstats.png)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Wood trimmed reverse reads:\n",
    "![](rawWoodReadsR2_fastxstats.png)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Wood merged reads:\n",
    "![](woodMerged_fastxstats.png)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id=\"qf\"><h3>Quality filtering reads</h3></a>\n",
    "\n",
    "USEARCH does quite a bit of filtering in the merging process, I think, based on how many reads from our wood samples were removed. But let's also use the USEARCH filtering program on both wood and leaf reads."
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<h4>Filter leaves</h4>"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "## leaves\n",
    "\n",
    "cd /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/merged\n",
    "\n",
    "for i in *; do\n",
    "    out=${i/.merged.fastq/\\.merged\\.filt\\.fastq}\n",
    "    #echo $i $out\n",
    "    usearch -fastq_filter $i -fastq_maxee_rate .01 -fastqout \"../filtered/\"$out -notrunclabels &>> ../filtered/leaf_mergeStdout.txt\n",
    "done\n"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 4,
   "metadata": {
    "scrolled": true
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 97.5% passed\n",
      "    102021  FASTQ recs (102.0k)            \n",
      "     99492  Converted (99.5k, 97.5%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.2% passed\n",
      "    104711  FASTQ recs (104.7k)            \n",
      "    102793  Converted (102.8k, 98.2%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 98.1% passed\n",
      "    104701  FASTQ recs (104.7k)            \n",
      "    102708  Converted (102.7k, 98.1%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 97.0% passed\n",
      "     99536  FASTQ recs (99.5k)             \n",
      "     96574  Converted (96.6k, 97.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 97.8% passed\n",
      "    104097  FASTQ recs (104.1k)            \n",
      "    101822  Converted (101.8k, 97.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 98.3% passed\n",
      "    106110  FASTQ recs (106.1k)            \n",
      "    104283  Converted (104.3k, 98.3%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.1% passed\n",
      "    104995  FASTQ recs (105.0k)            \n",
      "    102967  Converted (103.0k, 98.1%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 96.9% passed\n",
      "     99563  FASTQ recs (99.6k)             \n",
      "     96519  Converted (96.5k, 96.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 97.9% passed\n",
      "    104121  FASTQ recs (104.1k)            \n",
      "    101896  Converted (101.9k, 97.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.1% passed\n",
      "    105741  FASTQ recs (105.7k)            \n",
      "    103771  Converted (103.8k, 98.1%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 97.9% passed\n",
      "    105016  FASTQ recs (105.0k)            \n",
      "    102811  Converted (102.8k, 97.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 94.4% passed\n",
      "     99841  FASTQ recs (99.8k)             \n",
      "     94279  Converted (94.3k, 94.4%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 94.5% passed\n",
      "    104590  FASTQ recs (104.6k)            \n",
      "     98806  Converted (98.8k, 94.5%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 94.6% passed\n",
      "    105189  FASTQ recs (105.2k)            \n",
      "     99559  Converted (99.6k, 94.6%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 93.7% passed\n",
      "    101581  FASTQ recs (101.6k)            \n",
      "     95145  Converted (95.1k, 93.7%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 93.7% passed\n",
      "     99584  FASTQ recs (99.6k)             \n",
      "     93274  Converted (93.3k, 93.7%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 97.1% passed\n",
      "    104853  FASTQ recs (104.9k)            \n",
      "    101835  Converted (101.8k, 97.1%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 97.2% passed\n",
      "    105493  FASTQ recs (105.5k)            \n",
      "    102554  Converted (102.6k, 97.2%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 96.7% passed\n",
      "    104259  FASTQ recs (104.3k)            \n",
      "    100797  Converted (100.8k, 96.7%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 95.2% passed\n",
      "     99544  FASTQ recs (99.5k)             \n",
      "     94741  Converted (94.7k, 95.2%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 97.0% passed\n",
      "    104572  FASTQ recs (104.6k)            \n",
      "    101399  Converted (101.4k, 97.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 97.1% passed\n",
      "    105138  FASTQ recs (105.1k)            \n",
      "    102065  Converted (102.1k, 97.1%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 96.3% passed\n",
      "    102850  FASTQ recs (102.8k)            \n",
      "     99075  Converted (99.1k, 96.3%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 96.5% passed\n",
      "    100230  FASTQ recs (100.2k)            \n",
      "     96754  Converted (96.8k, 96.5%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 98.1% passed\n",
      "    105195  FASTQ recs (105.2k)            \n",
      "    103203  Converted (103.2k, 98.1%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.1% passed\n",
      "    105544  FASTQ recs (105.5k)            \n",
      "    103498  Converted (103.5k, 98.1%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 97.6% passed\n",
      "    102999  FASTQ recs (103.0k)            \n",
      "    100516  Converted (100.5k, 97.6%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 97.1% passed\n",
      "    100736  FASTQ recs (100.7k)            \n",
      "     97824  Converted (97.8k, 97.1%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.2% passed\n",
      "    105062  FASTQ recs (105.1k)            \n",
      "    103173  Converted (103.2k, 98.2%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.2% passed\n",
      "    105215  FASTQ recs (105.2k)            \n",
      "    103288  Converted (103.3k, 98.2%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 97.4% passed\n",
      "     96035  FASTQ recs (96.0k)             \n",
      "     93508  Converted (93.5k, 97.4%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 98.0% passed\n",
      "     99723  FASTQ recs (99.7k)             \n",
      "     97758  Converted (97.8k, 98.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.8% passed \n",
      "    104830  FASTQ recs (104.8k)            \n",
      "    103615  Converted (103.6k, 98.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.8% passed\n",
      "    105066  FASTQ recs (105.1k)            \n",
      "    103836  Converted (103.8k, 98.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 97.9% passed\n",
      "     95024  FASTQ recs (95.0k)             \n",
      "     93055  Converted (93.1k, 97.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 97.7% passed\n",
      "    102551  FASTQ recs (102.6k)            \n",
      "    100222  Converted (100.2k, 97.7%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.1% passed \n",
      "    105159  FASTQ recs (105.2k)            \n",
      "    103136  Converted (103.1k, 98.1%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.0% passed\n",
      "    104623  FASTQ recs (104.6k)            \n",
      "    102498  Converted (102.5k, 98.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 96.2% passed\n",
      "     97438  FASTQ recs (97.4k)             \n",
      "     93746  Converted (93.7k, 96.2%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 96.4% passed \n",
      "    103220  FASTQ recs (103.2k)            \n",
      "     99515  Converted (99.5k, 96.4%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 97.1% passed \n",
      "    105366  FASTQ recs (105.4k)            \n",
      "    102339  Converted (102.3k, 97.1%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 96.9% passed\n",
      "    104929  FASTQ recs (104.9k)            \n",
      "    101677  Converted (101.7k, 96.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 95.2% passed \n",
      "    100387  FASTQ recs (100.4k)            \n",
      "     95595  Converted (95.6k, 95.2%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 96.7% passed\n",
      "    103947  FASTQ recs (103.9k)            \n",
      "    100527  Converted (100.5k, 96.7%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 97.1% passed\n",
      "    105548  FASTQ recs (105.5k)            \n",
      "    102489  Converted (102.5k, 97.1%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 97.0% passed\n",
      "    105124  FASTQ recs (105.1k)            \n",
      "    101961  Converted (102.0k, 97.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 95.2% passed\n",
      "    100070  FASTQ recs (100.1k)            \n",
      "     95274  Converted (95.3k, 95.2%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 96.4% passed \n",
      "    104032  FASTQ recs (104.0k)            \n",
      "    100308  Converted (100.3k, 96.4%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 96.8% passed\n",
      "    105139  FASTQ recs (105.1k)            \n",
      "    101822  Converted (101.8k, 96.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 96.5% passed\n",
      "    104236  FASTQ recs (104.2k)            \n",
      "    100581  Converted (100.6k, 96.5%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 94.5% passed\n",
      "     98973  FASTQ recs (99.0k)             \n",
      "     93526  Converted (93.5k, 94.5%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 96.5% passed \n",
      "    103838  FASTQ recs (103.8k)            \n",
      "    100223  Converted (100.2k, 96.5%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "\n",
      "00:02  32Mb  100.0% Filtering, 96.8% passed\n",
      "    104980  FASTQ recs (105.0k)            \n",
      "    101625  Converted (101.6k, 96.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 96.4% passed\n",
      "    103707  FASTQ recs (103.7k)            \n",
      "     99960  Converted (100.0k, 96.4%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 94.5% passed \n",
      "     98488  FASTQ recs (98.5k)             \n",
      "     93055  Converted (93.1k, 94.5%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 96.5% passed\n",
      "    103949  FASTQ recs (103.9k)            \n",
      "    100269  Converted (100.3k, 96.5%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 96.7% passed\n",
      "    104798  FASTQ recs (104.8k)            \n",
      "    101343  Converted (101.3k, 96.7%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 96.2% passed\n",
      "    103490  FASTQ recs (103.5k)            \n",
      "     99580  Converted (99.6k, 96.2%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 94.3% passed\n",
      "     99138  FASTQ recs (99.1k)             \n",
      "     93534  Converted (93.5k, 94.3%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 96.5% passed \n",
      "    104421  FASTQ recs (104.4k)            \n",
      "    100730  Converted (100.7k, 96.5%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 96.7% passed\n",
      "    104992  FASTQ recs (105.0k)            \n",
      "    101500  Converted (101.5k, 96.7%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 95.9% passed\n",
      "    102862  FASTQ recs (102.9k)            \n",
      "     98686  Converted (98.7k, 95.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 94.4% passed\n",
      "     97951  FASTQ recs (98.0k)             \n",
      "     92441  Converted (92.4k, 94.4%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 96.4% passed\n",
      "    103805  FASTQ recs (103.8k)            \n",
      "    100020  Converted (100.0k, 96.4%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 96.6% passed\n",
      "    104411  FASTQ recs (104.4k)            \n",
      "    100907  Converted (100.9k, 96.6%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:03  32Mb  100.0% Filtering, 95.5% passed\n",
      "    100151  FASTQ recs (100.2k)            \n",
      "     95597  Converted (95.6k, 95.5%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 91.3% passed\n",
      "     99190  FASTQ recs (99.2k)             \n",
      "     90519  Converted (90.5k, 91.3%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 93.7% passed\n",
      "    103356  FASTQ recs (103.4k)            \n",
      "     96884  Converted (96.9k, 93.7%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 93.8% passed \n",
      "    103209  FASTQ recs (103.2k)            \n",
      "     96782  Converted (96.8k, 93.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 92.8% passed\n",
      "     98400  FASTQ recs (98.4k)             \n",
      "     91293  Converted (91.3k, 92.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 97.3% passed\n",
      "    101023  FASTQ recs (101.0k)            \n",
      "     98251  Converted (98.3k, 97.3%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 97.8% passed\n",
      "    103945  FASTQ recs (103.9k)            \n",
      "    101660  Converted (101.7k, 97.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 97.8% passed\n",
      "    104106  FASTQ recs (104.1k)            \n",
      "    101820  Converted (101.8k, 97.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 97.1% passed\n",
      "    100233  FASTQ recs (100.2k)            \n",
      "     97285  Converted (97.3k, 97.1%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 97.9% passed \n",
      "    100127  FASTQ recs (100.1k)            \n",
      "     98004  Converted (98.0k, 97.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.1% passed \n",
      "    101255  FASTQ recs (101.3k)            \n",
      "     99310  Converted (99.3k, 98.1%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 97.6% passed \n",
      "    100029  FASTQ recs (100.0k)            \n",
      "     97649  Converted (97.6k, 97.6%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 97.2% passed\n",
      "     96702  FASTQ recs (96.7k)             \n",
      "     93946  Converted (93.9k, 97.2%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.2% passed\n",
      "    101291  FASTQ recs (101.3k)            \n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "     99443  Converted (99.4k, 98.2%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.2% passed\n",
      "    102558  FASTQ recs (102.6k)            \n",
      "    100694  Converted (100.7k, 98.2%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 97.6% passed\n",
      "     98963  FASTQ recs (99.0k)             \n",
      "     96545  Converted (96.5k, 97.6%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 97.4% passed\n",
      "     98644  FASTQ recs (98.6k)             \n",
      "     96079  Converted (96.1k, 97.4%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.1% passed\n",
      "    102194  FASTQ recs (102.2k)            \n",
      "    100302  Converted (100.3k, 98.1%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.2% passed\n",
      "    102579  FASTQ recs (102.6k)            \n",
      "    100701  Converted (100.7k, 98.2%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 97.6% passed\n",
      "     98358  FASTQ recs (98.4k)             \n",
      "     96032  Converted (96.0k, 97.6%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.7% passed \n",
      "    102792  FASTQ recs (102.8k)            \n",
      "    101464  Converted (101.5k, 98.7%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.8% passed\n",
      "    103428  FASTQ recs (103.4k)            \n",
      "    102223  Converted (102.2k, 98.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.7% passed\n",
      "    103472  FASTQ recs (103.5k)            \n",
      "    102148  Converted (102.1k, 98.7%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.3% passed\n",
      "     98391  FASTQ recs (98.4k)             \n",
      "     96686  Converted (96.7k, 98.3%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.8% passed \n",
      "    102747  FASTQ recs (102.7k)            \n",
      "    101487  Converted (101.5k, 98.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.9% passed \n",
      "    103453  FASTQ recs (103.5k)            \n",
      "    102313  Converted (102.3k, 98.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.7% passed \n",
      "    102438  FASTQ recs (102.4k)            \n",
      "    101147  Converted (101.1k, 98.7%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.2% passed \n",
      "     99162  FASTQ recs (99.2k)             \n",
      "     97426  Converted (97.4k, 98.2%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.8% passed\n",
      "    102961  FASTQ recs (103.0k)            \n",
      "    101709  Converted (101.7k, 98.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.7% passed\n",
      "    103483  FASTQ recs (103.5k)            \n",
      "    102166  Converted (102.2k, 98.7%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.5% passed \n",
      "    101226  FASTQ recs (101.2k)            \n",
      "     99731  Converted (99.7k, 98.5%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 97.4% passed\n",
      "     98645  FASTQ recs (98.6k)             \n",
      "     96090  Converted (96.1k, 97.4%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.1% passed \n",
      "    101959  FASTQ recs (102.0k)            \n",
      "    100006  Converted (100.0k, 98.1%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.0% passed\n",
      "    102327  FASTQ recs (102.3k)            \n",
      "    100278  Converted (100.3k, 98.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 97.3% passed \n",
      "     98515  FASTQ recs (98.5k)             \n",
      "     95882  Converted (95.9k, 97.3%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.5% passed \n",
      "    102041  FASTQ recs (102.0k)            \n",
      "    100539  Converted (100.5k, 98.5%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.8% passed\n",
      "    103344  FASTQ recs (103.3k)            \n",
      "    102074  Converted (102.1k, 98.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.8% passed\n",
      "    103572  FASTQ recs (103.6k)            \n",
      "    102319  Converted (102.3k, 98.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.1% passed\n",
      "     98253  FASTQ recs (98.3k)             \n",
      "     96364  Converted (96.4k, 98.1%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.5% passed \n",
      "    102064  FASTQ recs (102.1k)            \n",
      "    100536  Converted (100.5k, 98.5%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.7% passed \n",
      "    102947  FASTQ recs (102.9k)            \n",
      "    101629  Converted (101.6k, 98.7%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.8% passed\n",
      "    103653  FASTQ recs (103.7k)            \n",
      "    102394  Converted (102.4k, 98.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.2% passed\n",
      "     98820  FASTQ recs (98.8k)             \n",
      "     97054  Converted (97.1k, 98.2%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.7% passed \n",
      "    102450  FASTQ recs (102.5k)            \n",
      "    101123  Converted (101.1k, 98.7%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.8% passed \n",
      "    103384  FASTQ recs (103.4k)            \n",
      "    102096  Converted (102.1k, 98.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.6% passed \n",
      "    102380  FASTQ recs (102.4k)            \n",
      "    100925  Converted (100.9k, 98.6%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 97.5% passed\n",
      "     97458  FASTQ recs (97.5k)             \n",
      "     95064  Converted (95.1k, 97.5%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.0% passed\n",
      "    101408  FASTQ recs (101.4k)            \n",
      "     99399  Converted (99.4k, 98.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.2% passed \n",
      "    102172  FASTQ recs (102.2k)            \n",
      "    100316  Converted (100.3k, 98.2%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 97.8% passed\n",
      "    100680  FASTQ recs (100.7k)            \n",
      "     98479  Converted (98.5k, 97.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 97.9% passed\n",
      "     98752  FASTQ recs (98.8k)             \n",
      "     96719  Converted (96.7k, 97.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.7% passed\n",
      "    102997  FASTQ recs (103.0k)            \n",
      "    101616  Converted (101.6k, 98.7%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.8% passed \n",
      "    103510  FASTQ recs (103.5k)            \n",
      "    102239  Converted (102.2k, 98.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.3% passed\n",
      "     99379  FASTQ recs (99.4k)             \n",
      "     97649  Converted (97.6k, 98.3%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 97.4% passed\n",
      "     99878  FASTQ recs (99.9k)             \n",
      "     97298  Converted (97.3k, 97.4%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.0% passed \n",
      "    102190  FASTQ recs (102.2k)            \n",
      "    100135  Converted (100.1k, 98.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.0% passed\n",
      "    102047  FASTQ recs (102.0k)            \n",
      "     99994  Converted (100.0k, 98.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 96.0% passed \n",
      "     96696  FASTQ recs (96.7k)             \n",
      "     92811  Converted (92.8k, 96.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 94.3% passed\n",
      "     98477  FASTQ recs (98.5k)             \n",
      "     92856  Converted (92.9k, 94.3%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 95.2% passed\n",
      "    100366  FASTQ recs (100.4k)            \n",
      "     95546  Converted (95.5k, 95.2%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 94.9% passed\n",
      "    100509  FASTQ recs (100.5k)            \n",
      "     95336  Converted (95.3k, 94.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 94.4% passed \n",
      "     95128  FASTQ recs (95.1k)             \n",
      "     89786  Converted (89.8k, 94.4%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.5% passed\n",
      "    101503  FASTQ recs (101.5k)            \n",
      "    100028  Converted (100.0k, 98.5%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.6% passed\n",
      "    102618  FASTQ recs (102.6k)            \n",
      "    101198  Converted (101.2k, 98.6%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.5% passed\n",
      "    102491  FASTQ recs (102.5k)            \n",
      "    100966  Converted (101.0k, 98.5%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 97.3% passed \n",
      "     95876  FASTQ recs (95.9k)             \n",
      "     93265  Converted (93.3k, 97.3%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 97.8% passed \n",
      "     99553  FASTQ recs (99.6k)             \n",
      "     97330  Converted (97.3k, 97.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.0% passed\n",
      "    100658  FASTQ recs (100.7k)            \n",
      "     98680  Converted (98.7k, 98.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 97.7% passed\n",
      "     99534  FASTQ recs (99.5k)             \n",
      "     97261  Converted (97.3k, 97.7%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 96.6% passed\n",
      "     94668  FASTQ recs (94.7k)             \n",
      "     91461  Converted (91.5k, 96.6%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 97.7% passed\n",
      "    100720  FASTQ recs (100.7k)            \n",
      "     98448  Converted (98.4k, 97.7%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 97.8% passed\n",
      "    101679  FASTQ recs (101.7k)            \n",
      "     99476  Converted (99.5k, 97.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 97.4% passed\n",
      "     99366  FASTQ recs (99.4k)             \n",
      "     96803  Converted (96.8k, 97.4%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 86.8% passed\n",
      "     93204  FASTQ recs (93.2k)             \n",
      "     80891  Converted (80.9k, 86.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 90.8% passed \n",
      "     98987  FASTQ recs (99.0k)             \n",
      "     89917  Converted (89.9k, 90.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 91.0% passed\n",
      "     99369  FASTQ recs (99.4k)             \n",
      "     90392  Converted (90.4k, 91.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 89.2% passed\n",
      "     94756  FASTQ recs (94.8k)             \n",
      "     84479  Converted (84.5k, 89.2%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.3% passed\n",
      "    100272  FASTQ recs (100.3k)            \n",
      "     98587  Converted (98.6k, 98.3%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.6% passed \n",
      "    102424  FASTQ recs (102.4k)            \n",
      "    100999  Converted (101.0k, 98.6%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02  32Mb  100.0% Filtering, 98.6% passed \n",
      "    102610  FASTQ recs (102.6k)            \n",
      "    101166  Converted (101.2k, 98.6%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 98.2% passed \n",
      "     61798  FASTQ recs (61.8k)             \n",
      "     60687  Converted (60.7k, 98.2%)\n"
     ]
    }
   ],
   "source": [
    "cat leaf_filterStdout.txt"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<h4>Filter wood</h4>"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "## wood\n",
    "cd /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/merged\n",
    "\n",
    "for i in *; do\n",
    "    out=${i/.fastq.merged.fastq/\\.merge\\.filt\\.fastq}\n",
    "    usearch -fastq_filter $i -fastq_maxee_rate .01 -fastqout $out -notrunclabels &>> wood_filterStdout.txt\n",
    "done\n"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 2,
   "metadata": {
    "scrolled": true
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     61717  FASTQ recs (61.7k)              \n",
      "     61717  Converted (61.7k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     44977  FASTQ recs (45.0k)              \n",
      "     44975  Converted (45.0k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 99.8% passed\n",
      "     37537  FASTQ recs (37.5k)             \n",
      "     37462  Converted (37.5k, 99.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 99.6% passed\n",
      "     17141  FASTQ recs (17.1k)             \n",
      "     17079  Converted (17.1k, 99.6%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 99.9% passed\n",
      "     30977  FASTQ recs (31.0k)             \n",
      "     30951  Converted (31.0k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     44386  FASTQ recs (44.4k)              \n",
      "     44377  Converted (44.4k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     26557  FASTQ recs (26.6k)              \n",
      "     26545  Converted (26.5k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     48013  FASTQ recs (48.0k)              \n",
      "     48010  Converted (48.0k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 99.8% passed\n",
      "     29113  FASTQ recs (29.1k)             \n",
      "     29049  Converted (29.0k, 99.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     51790  FASTQ recs (51.8k)              \n",
      "     51778  Converted (51.8k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     45330  FASTQ recs (45.3k)              \n",
      "     45329  Converted (45.3k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     44558  FASTQ recs (44.6k)              \n",
      "     44550  Converted (44.5k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     32725  FASTQ recs (32.7k)              \n",
      "     32720  Converted (32.7k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     26854  FASTQ recs (26.9k)              \n",
      "     26853  Converted (26.9k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     32122  FASTQ recs (32.1k)              \n",
      "     32106  Converted (32.1k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 99.9% passed \n",
      "     29772  FASTQ recs (29.8k)             \n",
      "     29733  Converted (29.7k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 99.9% passed\n",
      "     18812  FASTQ recs (18.8k)             \n",
      "     18788  Converted (18.8k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     49402  FASTQ recs (49.4k)              \n",
      "     49393  Converted (49.4k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 99.9% passed \n",
      "     48397  FASTQ recs (48.4k)             \n",
      "     48365  Converted (48.4k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 99.8% passed\n",
      "     27577  FASTQ recs (27.6k)             \n",
      "     27511  Converted (27.5k, 99.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     16388  FASTQ recs (16.4k)              \n",
      "     16381  Converted (16.4k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 99.9% passed \n",
      "     44077  FASTQ recs (44.1k)             \n",
      "     44017  Converted (44.0k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     52684  FASTQ recs (52.7k)              \n",
      "     52683  Converted (52.7k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 99.9% passed\n",
      "     36068  FASTQ recs (36.1k)             \n",
      "     36037  Converted (36.0k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     65064  FASTQ recs (65.1k)              \n",
      "     65050  Converted (65.0k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     43556  FASTQ recs (43.6k)              \n",
      "     43556  Converted (43.6k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 99.9% passed\n",
      "     43527  FASTQ recs (43.5k)             \n",
      "     43484  Converted (43.5k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     56663  FASTQ recs (56.7k)              \n",
      "     56656  Converted (56.7k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     55294  FASTQ recs (55.3k)              \n",
      "     55293  Converted (55.3k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     68878  FASTQ recs (68.9k)              \n",
      "     68876  Converted (68.9k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     34954  FASTQ recs (35.0k)              \n",
      "     34952  Converted (35.0k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     32874  FASTQ recs (32.9k)              \n",
      "     32858  Converted (32.9k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 99.9% passed\n",
      "     40077  FASTQ recs (40.1k)             \n",
      "     40056  Converted (40.1k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     55539  FASTQ recs (55.5k)              \n",
      "     55535  Converted (55.5k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 99.8% passed\n",
      "     36211  FASTQ recs (36.2k)             \n",
      "     36142  Converted (36.1k, 99.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     53462  FASTQ recs (53.5k)              \n",
      "     53459  Converted (53.5k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     42950  FASTQ recs (43.0k)              \n",
      "     42947  Converted (42.9k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     20790  FASTQ recs (20.8k)              \n",
      "     20785  Converted (20.8k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     40009  FASTQ recs (40.0k)              \n",
      "     40003  Converted (40.0k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     32756  FASTQ recs (32.8k)              \n",
      "     32744  Converted (32.7k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     64570  FASTQ recs (64.6k)              \n",
      "     64561  Converted (64.6k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 99.9% passed\n",
      "     30739  FASTQ recs (30.7k)             \n",
      "     30722  Converted (30.7k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 99.9% passed\n",
      "     34855  FASTQ recs (34.9k)             \n",
      "     34837  Converted (34.8k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     43982  FASTQ recs (44.0k)              \n",
      "     43974  Converted (44.0k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     38801  FASTQ recs (38.8k)              \n",
      "     38789  Converted (38.8k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     56721  FASTQ recs (56.7k)              \n",
      "     56706  Converted (56.7k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 99.9% passed\n",
      "     35445  FASTQ recs (35.4k)             \n",
      "     35412  Converted (35.4k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     38195  FASTQ recs (38.2k)              \n",
      "     38176  Converted (38.2k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     45208  FASTQ recs (45.2k)              \n",
      "     45202  Converted (45.2k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     52051  FASTQ recs (52.1k)              \n",
      "     52038  Converted (52.0k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     23129  FASTQ recs (23.1k)              \n",
      "     23127  Converted (23.1k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 99.7% passed\n",
      "      8938  FASTQ recs (8938)              \n",
      "      8913  Converted (8913, 99.7%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     42057  FASTQ recs (42.1k)              \n",
      "     42053  Converted (42.1k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     38095  FASTQ recs (38.1k)              \n",
      "     38085  Converted (38.1k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     34455  FASTQ recs (34.5k)              \n",
      "     34443  Converted (34.4k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     42656  FASTQ recs (42.7k)              \n",
      "     42640  Converted (42.6k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     44886  FASTQ recs (44.9k)              \n",
      "     44885  Converted (44.9k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     43179  FASTQ recs (43.2k)              \n",
      "     43172  Converted (43.2k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     61191  FASTQ recs (61.2k)              \n",
      "     61181  Converted (61.2k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 99.9% passed\n",
      "     24712  FASTQ recs (24.7k)             \n",
      "     24691  Converted (24.7k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     42988  FASTQ recs (43.0k)              \n",
      "     42984  Converted (43.0k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     50513  FASTQ recs (50.5k)              \n",
      "     50505  Converted (50.5k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     49224  FASTQ recs (49.2k)              \n",
      "     49211  Converted (49.2k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 99.9% passed\n",
      "     48041  FASTQ recs (48.0k)             \n",
      "     47997  Converted (48.0k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     59350  FASTQ recs (59.4k)              \n",
      "     59336  Converted (59.3k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     41318  FASTQ recs (41.3k)              \n",
      "     41299  Converted (41.3k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 99.6% passed \n",
      "     30394  FASTQ recs (30.4k)             \n",
      "     30271  Converted (30.3k, 99.6%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 98.9% passed\n",
      "     25361  FASTQ recs (25.4k)             \n",
      "     25083  Converted (25.1k, 98.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     62723  FASTQ recs (62.7k)              \n",
      "     62721  Converted (62.7k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     49128  FASTQ recs (49.1k)              \n",
      "     49122  Converted (49.1k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     44147  FASTQ recs (44.1k)              \n",
      "     44144  Converted (44.1k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 99.9% passed\n",
      "     37231  FASTQ recs (37.2k)             \n",
      "     37202  Converted (37.2k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     26737  FASTQ recs (26.7k)              \n",
      "     26731  Converted (26.7k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     10642  FASTQ recs (10.6k)              \n",
      "     10641  Converted (10.6k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     21253  FASTQ recs (21.3k)              \n",
      "     21248  Converted (21.2k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 99.9% passed\n",
      "     23286  FASTQ recs (23.3k)             \n",
      "     23268  Converted (23.3k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 99.9% passed \n",
      "     24924  FASTQ recs (24.9k)             \n",
      "     24908  Converted (24.9k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     24709  FASTQ recs (24.7k)              \n",
      "     24703  Converted (24.7k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     35103  FASTQ recs (35.1k)              \n",
      "     35091  Converted (35.1k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 99.9% passed\n",
      "     26257  FASTQ recs (26.3k)             \n",
      "     26224  Converted (26.2k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 99.9% passed \n",
      "     36638  FASTQ recs (36.6k)             \n",
      "     36597  Converted (36.6k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     18107  FASTQ recs (18.1k)              \n",
      "     18100  Converted (18.1k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 99.8% passed\n",
      "     18586  FASTQ recs (18.6k)             \n",
      "     18552  Converted (18.6k, 99.8%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     29724  FASTQ recs (29.7k)              \n",
      "     29723  Converted (29.7k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 99.9% passed\n",
      "     29888  FASTQ recs (29.9k)             \n",
      "     29872  Converted (29.9k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     21269  FASTQ recs (21.3k)              \n",
      "     21261  Converted (21.3k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 99.9% passed\n",
      "     30675  FASTQ recs (30.7k)             \n",
      "     30651  Converted (30.7k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     47727  FASTQ recs (47.7k)              \n",
      "     47719  Converted (47.7k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     35795  FASTQ recs (35.8k)              \n",
      "     35793  Converted (35.8k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     44893  FASTQ recs (44.9k)              \n",
      "     44891  Converted (44.9k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     48832  FASTQ recs (48.8k)              \n",
      "     48829  Converted (48.8k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 99.9% passed \n",
      "     36067  FASTQ recs (36.1k)             \n",
      "     36013  Converted (36.0k, 99.9%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     18556  FASTQ recs (18.6k)              \n",
      "     18551  Converted (18.6k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     31750  FASTQ recs (31.8k)              \n",
      "     31741  Converted (31.7k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 100.0% passed\n",
      "     37531  FASTQ recs (37.5k)              \n",
      "     37523  Converted (37.5k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  32Mb  100.0% Filtering, 99.7% passed\n",
      "      1519  FASTQ recs (1519)              \n",
      "      1514  Converted (1514, 99.7%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 100.0% passed\n",
      "     60281  FASTQ recs (60.3k)              \n",
      "     60280  Converted (60.3k, 100.0%)\n",
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:01  32Mb  100.0% Filtering, 99.9% passed\n",
      "     40475  FASTQ recs (40.5k)             \n",
      "     40424  Converted (40.4k, 99.9%)\n"
     ]
    }
   ],
   "source": [
    "cat wood_filterStdout.txt"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id=\"fastq2fasta\"><h3>Convert fastq files to fasta format</h3></a>\n",
    "\n",
    "Let's use [BBMap tools](https://sourceforge.net/projects/bbmap/) to do the conversion. FASTX toolbox has something for this also, but FASTX is a little brittle when dealing with fastq files in modern illumina quality scores, etc., and sometimes generates funny errors. "
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<h4>Leaf reads</h4>"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "## drop bbtools into a nearby directory. Java, so can't really put in bin folders. \n",
    "bb=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap\n",
    "\n",
    "## just one large leaf file\n",
    "$bb/reformat.sh in=leaf_merged_filt.fastq \\\n",
    "    out=leaf_merged_filt.fasta\\\n",
    "    fastawrap=0 \\\n",
    "    &> makeLeafFasta.txt"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Outputs from bbmap for this:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 10,
   "metadata": {
    "scrolled": true
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=leaf_merged_filt.fastq out=leaf_merged_filt.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=leaf_merged_filt.fastq, out=leaf_merged_filt.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t14372164 reads          \t4600246850 bases\n",
      "Output:                 \t14372164 reads (100.00%) \t4600246850 bases (100.00%)\n",
      "\n",
      "Time:                         \t151.584 seconds.\n",
      "Reads Processed:      14372k \t94.81k reads/sec\n",
      "Bases Processed:       4600m \t30.35m bases/sec\n"
     ]
    }
   ],
   "source": [
    "cat makeLeafFasta.txt"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<h4>Wood reads</h4>"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 5,
   "metadata": {},
   "outputs": [],
   "source": [
    "## wood to fasta, lots of smaller files:\n",
    "wfd=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/\n",
    "\n",
    "cd /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/filtered\n",
    "\n",
    "for i in *; do\n",
    "$bb/reformat.sh in=$i \\\n",
    "    out=$wfd${i/_R1_trimmed.merge.filt.fastq/.fasta} \\\n",
    "    fastawrap=0 \\\n",
    "    &>> ../../woodFastaStdout.txt\n",
    "done"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 11,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s160-index-AAGCACTG-GTGATCCANNNN-Dc-X_S160_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s160-index-AAGCACTG-GTGATCCANNNN-Dc-X_S160_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s160-index-AAGCACTG-GTGATCCANNNN-Dc-X_S160_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s160-index-AAGCACTG-GTGATCCANNNN-Dc-X_S160_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t61717 reads          \t15788419 bases\n",
      "Output:                 \t61717 reads (100.00%) \t15788419 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.638 seconds.\n",
      "Reads Processed:       61717 \t96.76k reads/sec\n",
      "Bases Processed:      15788k \t24.75m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s161-index-AAGCACTG-TTCGTACGNNNN-Dc-PosG_S161_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s161-index-AAGCACTG-TTCGTACGNNNN-Dc-PosG_S161_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s161-index-AAGCACTG-TTCGTACGNNNN-Dc-PosG_S161_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s161-index-AAGCACTG-TTCGTACGNNNN-Dc-PosG_S161_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t44975 reads          \t11367722 bases\n",
      "Output:                 \t44975 reads (100.00%) \t11367722 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.582 seconds.\n",
      "Reads Processed:       44975 \t77.23k reads/sec\n",
      "Bases Processed:      11367k \t19.52m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s162-index-AAGCACTG-ATGACAGGNNNN-Dc-PosI_S162_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s162-index-AAGCACTG-ATGACAGGNNNN-Dc-PosI_S162_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s162-index-AAGCACTG-ATGACAGGNNNN-Dc-PosI_S162_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s162-index-AAGCACTG-ATGACAGGNNNN-Dc-PosI_S162_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t37462 reads          \t9759644 bases\n",
      "Output:                 \t37462 reads (100.00%) \t9759644 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.344 seconds.\n",
      "Reads Processed:       37462 \t109.05k reads/sec\n",
      "Bases Processed:       9759k \t28.41m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s163-index-AAGCACTG-CGACCTAANNNN-Dc-Neg_S163_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s163-index-AAGCACTG-CGACCTAANNNN-Dc-Neg_S163_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s163-index-AAGCACTG-CGACCTAANNNN-Dc-Neg_S163_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s163-index-AAGCACTG-CGACCTAANNNN-Dc-Neg_S163_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t17079 reads          \t4126258 bases\n",
      "Output:                 \t17079 reads (100.00%) \t4126258 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.256 seconds.\n",
      "Reads Processed:       17079 \t66.74k reads/sec\n",
      "Bases Processed:       4126k \t16.12m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s164-index-CTAGGTGA-GACACAGTNNNN-1w_S164_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s164-index-CTAGGTGA-GACACAGTNNNN-1w_S164_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s164-index-CTAGGTGA-GACACAGTNNNN-1w_S164_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s164-index-CTAGGTGA-GACACAGTNNNN-1w_S164_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t30951 reads          \t7473449 bases\n",
      "Output:                 \t30951 reads (100.00%) \t7473449 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.300 seconds.\n",
      "Reads Processed:       30951 \t103.28k reads/sec\n",
      "Bases Processed:       7473k \t24.94m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s165-index-ACGACTTG-GACACAGTNNNN-2w_S165_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s165-index-ACGACTTG-GACACAGTNNNN-2w_S165_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s165-index-ACGACTTG-GACACAGTNNNN-2w_S165_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s165-index-ACGACTTG-GACACAGTNNNN-2w_S165_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t44377 reads          \t11192488 bases\n",
      "Output:                 \t44377 reads (100.00%) \t11192488 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.356 seconds.\n",
      "Reads Processed:       44377 \t124.67k reads/sec\n",
      "Bases Processed:      11192k \t31.44m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s166-index-GCATACAG-GACACAGTNNNN-3w_S166_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s166-index-GCATACAG-GACACAGTNNNN-3w_S166_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s166-index-GCATACAG-GACACAGTNNNN-3w_S166_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s166-index-GCATACAG-GACACAGTNNNN-3w_S166_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t26545 reads          \t6140107 bases\n",
      "Output:                 \t26545 reads (100.00%) \t6140107 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.281 seconds.\n",
      "Reads Processed:       26545 \t94.33k reads/sec\n",
      "Bases Processed:       6140k \t21.82m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s167-index-TGCGAACT-GACACAGTNNNN-4w_S167_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s167-index-TGCGAACT-GACACAGTNNNN-4w_S167_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s167-index-TGCGAACT-GACACAGTNNNN-4w_S167_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s167-index-TGCGAACT-GACACAGTNNNN-4w_S167_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t48010 reads          \t11900026 bases\n",
      "Output:                 \t48010 reads (100.00%) \t11900026 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.374 seconds.\n",
      "Reads Processed:       48010 \t128.37k reads/sec\n",
      "Bases Processed:      11900k \t31.82m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s168-index-TCTCCGAT-GACACAGTNNNN-5w_S168_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s168-index-TCTCCGAT-GACACAGTNNNN-5w_S168_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s168-index-TCTCCGAT-GACACAGTNNNN-5w_S168_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s168-index-TCTCCGAT-GACACAGTNNNN-5w_S168_L001.fasta, fastawrap=0]\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t29049 reads          \t7036714 bases\n",
      "Output:                 \t29049 reads (100.00%) \t7036714 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.284 seconds.\n",
      "Reads Processed:       29049 \t102.32k reads/sec\n",
      "Bases Processed:       7036k \t24.79m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s169-index-GAGGACTT-GACACAGTNNNN-7w_S169_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s169-index-GAGGACTT-GACACAGTNNNN-7w_S169_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s169-index-GAGGACTT-GACACAGTNNNN-7w_S169_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s169-index-GAGGACTT-GACACAGTNNNN-7w_S169_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t51778 reads          \t12868924 bases\n",
      "Output:                 \t51778 reads (100.00%) \t12868924 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.448 seconds.\n",
      "Reads Processed:       51778 \t115.58k reads/sec\n",
      "Bases Processed:      12868k \t28.73m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s170-index-ACCATCCA-GACACAGTNNNN-9w_S170_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s170-index-ACCATCCA-GACACAGTNNNN-9w_S170_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s170-index-ACCATCCA-GACACAGTNNNN-9w_S170_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s170-index-ACCATCCA-GACACAGTNNNN-9w_S170_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t45329 reads          \t12205947 bases\n",
      "Output:                 \t45329 reads (100.00%) \t12205947 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.373 seconds.\n",
      "Reads Processed:       45329 \t121.68k reads/sec\n",
      "Bases Processed:      12205k \t32.77m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s171-index-CAACACCT-GACACAGTNNNN-10w_S171_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s171-index-CAACACCT-GACACAGTNNNN-10w_S171_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s171-index-CAACACCT-GACACAGTNNNN-10w_S171_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s171-index-CAACACCT-GACACAGTNNNN-10w_S171_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t44550 reads          \t12653456 bases\n",
      "Output:                 \t44550 reads (100.00%) \t12653456 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.560 seconds.\n",
      "Reads Processed:       44550 \t79.56k reads/sec\n",
      "Bases Processed:      12653k \t22.60m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s172-index-CTAGGTGA-GCATAACGNNNN-11w_S172_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s172-index-CTAGGTGA-GCATAACGNNNN-11w_S172_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s172-index-CTAGGTGA-GCATAACGNNNN-11w_S172_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s172-index-CTAGGTGA-GCATAACGNNNN-11w_S172_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t32720 reads          \t8010782 bases\n",
      "Output:                 \t32720 reads (100.00%) \t8010782 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.318 seconds.\n",
      "Reads Processed:       32720 \t102.78k reads/sec\n",
      "Bases Processed:       8010k \t25.16m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s173-index-ACGACTTG-GCATAACGNNNN-13w_S173_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s173-index-ACGACTTG-GCATAACGNNNN-13w_S173_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s173-index-ACGACTTG-GCATAACGNNNN-13w_S173_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s173-index-ACGACTTG-GCATAACGNNNN-13w_S173_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t26853 reads          \t6609581 bases\n",
      "Output:                 \t26853 reads (100.00%) \t6609581 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.292 seconds.\n",
      "Reads Processed:       26853 \t91.97k reads/sec\n",
      "Bases Processed:       6609k \t22.64m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s174-index-GCATACAG-GCATAACGNNNN-14w_S174_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s174-index-GCATACAG-GCATAACGNNNN-14w_S174_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s174-index-GCATACAG-GCATAACGNNNN-14w_S174_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s174-index-GCATACAG-GCATAACGNNNN-14w_S174_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t32106 reads          \t7892523 bases\n",
      "Output:                 \t32106 reads (100.00%) \t7892523 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.320 seconds.\n",
      "Reads Processed:       32106 \t100.41k reads/sec\n",
      "Bases Processed:       7892k \t24.68m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s175-index-TGCGAACT-GCATAACGNNNN-15w_S175_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s175-index-TGCGAACT-GCATAACGNNNN-15w_S175_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s175-index-TGCGAACT-GCATAACGNNNN-15w_S175_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s175-index-TGCGAACT-GCATAACGNNNN-15w_S175_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t29733 reads          \t7310003 bases\n",
      "Output:                 \t29733 reads (100.00%) \t7310003 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.305 seconds.\n",
      "Reads Processed:       29733 \t97.51k reads/sec\n",
      "Bases Processed:       7310k \t23.97m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s176-index-TCTCCGAT-GCATAACGNNNN-16w_S176_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s176-index-TCTCCGAT-GCATAACGNNNN-16w_S176_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s176-index-TCTCCGAT-GCATAACGNNNN-16w_S176_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s176-index-TCTCCGAT-GCATAACGNNNN-16w_S176_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t18788 reads          \t4705213 bases\n",
      "Output:                 \t18788 reads (100.00%) \t4705213 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.253 seconds.\n",
      "Reads Processed:       18788 \t74.20k reads/sec\n",
      "Bases Processed:       4705k \t18.58m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s177-index-GAGGACTT-GCATAACGNNNN-17w_S177_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s177-index-GAGGACTT-GCATAACGNNNN-17w_S177_L001.fasta fastawrap=0\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Executing jgi.ReformatReads [in=lane1-s177-index-GAGGACTT-GCATAACGNNNN-17w_S177_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s177-index-GAGGACTT-GCATAACGNNNN-17w_S177_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t49393 reads          \t11925772 bases\n",
      "Output:                 \t49393 reads (100.00%) \t11925772 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.364 seconds.\n",
      "Reads Processed:       49393 \t135.73k reads/sec\n",
      "Bases Processed:      11925k \t32.77m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s178-index-ACCATCCA-GCATAACGNNNN-18w_S178_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s178-index-ACCATCCA-GCATAACGNNNN-18w_S178_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s178-index-ACCATCCA-GCATAACGNNNN-18w_S178_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s178-index-ACCATCCA-GCATAACGNNNN-18w_S178_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t48365 reads          \t11220304 bases\n",
      "Output:                 \t48365 reads (100.00%) \t11220304 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.392 seconds.\n",
      "Reads Processed:       48365 \t123.48k reads/sec\n",
      "Bases Processed:      11220k \t28.65m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s179-index-CAACACCT-GCATAACGNNNN-19w_S179_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s179-index-CAACACCT-GCATAACGNNNN-19w_S179_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s179-index-CAACACCT-GCATAACGNNNN-19w_S179_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s179-index-CAACACCT-GCATAACGNNNN-19w_S179_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t27511 reads          \t6815101 bases\n",
      "Output:                 \t27511 reads (100.00%) \t6815101 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.295 seconds.\n",
      "Reads Processed:       27511 \t93.18k reads/sec\n",
      "Bases Processed:       6815k \t23.08m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s180-index-CTAGGTGA-ACAGAGGTNNNN-20w_S180_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s180-index-CTAGGTGA-ACAGAGGTNNNN-20w_S180_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s180-index-CTAGGTGA-ACAGAGGTNNNN-20w_S180_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s180-index-CTAGGTGA-ACAGAGGTNNNN-20w_S180_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t16381 reads          \t3977850 bases\n",
      "Output:                 \t16381 reads (100.00%) \t3977850 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.246 seconds.\n",
      "Reads Processed:       16381 \t66.65k reads/sec\n",
      "Bases Processed:       3977k \t16.19m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s181-index-ACGACTTG-ACAGAGGTNNNN-21w_S181_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s181-index-ACGACTTG-ACAGAGGTNNNN-21w_S181_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s181-index-ACGACTTG-ACAGAGGTNNNN-21w_S181_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s181-index-ACGACTTG-ACAGAGGTNNNN-21w_S181_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t44017 reads          \t10552175 bases\n",
      "Output:                 \t44017 reads (100.00%) \t10552175 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.583 seconds.\n",
      "Reads Processed:       44017 \t75.51k reads/sec\n",
      "Bases Processed:      10552k \t18.10m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s182-index-GCATACAG-ACAGAGGTNNNN-23w_S182_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s182-index-GCATACAG-ACAGAGGTNNNN-23w_S182_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s182-index-GCATACAG-ACAGAGGTNNNN-23w_S182_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s182-index-GCATACAG-ACAGAGGTNNNN-23w_S182_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t52683 reads          \t10889043 bases\n",
      "Output:                 \t52683 reads (100.00%) \t10889043 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.388 seconds.\n",
      "Reads Processed:       52683 \t135.91k reads/sec\n",
      "Bases Processed:      10889k \t28.09m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s183-index-TGCGAACT-ACAGAGGTNNNN-25w_S183_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s183-index-TGCGAACT-ACAGAGGTNNNN-25w_S183_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s183-index-TGCGAACT-ACAGAGGTNNNN-25w_S183_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s183-index-TGCGAACT-ACAGAGGTNNNN-25w_S183_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t36037 reads          \t10035894 bases\n",
      "Output:                 \t36037 reads (100.00%) \t10035894 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.320 seconds.\n",
      "Reads Processed:       36037 \t112.51k reads/sec\n",
      "Bases Processed:      10035k \t31.33m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s184-index-TCTCCGAT-ACAGAGGTNNNN-26w_S184_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s184-index-TCTCCGAT-ACAGAGGTNNNN-26w_S184_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s184-index-TCTCCGAT-ACAGAGGTNNNN-26w_S184_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s184-index-TCTCCGAT-ACAGAGGTNNNN-26w_S184_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t65050 reads          \t17811677 bases\n",
      "Output:                 \t65050 reads (100.00%) \t17811677 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.908 seconds.\n",
      "Reads Processed:       65050 \t71.66k reads/sec\n",
      "Bases Processed:      17811k \t19.62m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s185-index-GAGGACTT-ACAGAGGTNNNN-27w_S185_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s185-index-GAGGACTT-ACAGAGGTNNNN-27w_S185_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s185-index-GAGGACTT-ACAGAGGTNNNN-27w_S185_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s185-index-GAGGACTT-ACAGAGGTNNNN-27w_S185_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t43556 reads          \t10767375 bases\n",
      "Output:                 \t43556 reads (100.00%) \t10767375 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.357 seconds.\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Reads Processed:       43556 \t121.95k reads/sec\n",
      "Bases Processed:      10767k \t30.15m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s186-index-ACCATCCA-ACAGAGGTNNNN-28w_S186_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s186-index-ACCATCCA-ACAGAGGTNNNN-28w_S186_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s186-index-ACCATCCA-ACAGAGGTNNNN-28w_S186_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s186-index-ACCATCCA-ACAGAGGTNNNN-28w_S186_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t43484 reads          \t11231013 bases\n",
      "Output:                 \t43484 reads (100.00%) \t11231013 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.372 seconds.\n",
      "Reads Processed:       43484 \t116.89k reads/sec\n",
      "Bases Processed:      11231k \t30.19m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s187-index-CAACACCT-ACAGAGGTNNNN-29w_S187_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s187-index-CAACACCT-ACAGAGGTNNNN-29w_S187_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s187-index-CAACACCT-ACAGAGGTNNNN-29w_S187_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s187-index-CAACACCT-ACAGAGGTNNNN-29w_S187_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t56656 reads          \t13838702 bases\n",
      "Output:                 \t56656 reads (100.00%) \t13838702 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.712 seconds.\n",
      "Reads Processed:       56656 \t79.55k reads/sec\n",
      "Bases Processed:      13838k \t19.43m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s188-index-CTAGGTGA-CCACTAAGNNNN-30w_S188_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s188-index-CTAGGTGA-CCACTAAGNNNN-30w_S188_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s188-index-CTAGGTGA-CCACTAAGNNNN-30w_S188_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s188-index-CTAGGTGA-CCACTAAGNNNN-30w_S188_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t55293 reads          \t13069296 bases\n",
      "Output:                 \t55293 reads (100.00%) \t13069296 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.456 seconds.\n",
      "Reads Processed:       55293 \t121.39k reads/sec\n",
      "Bases Processed:      13069k \t28.69m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s189-index-ACGACTTG-CCACTAAGNNNN-31w_S189_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s189-index-ACGACTTG-CCACTAAGNNNN-31w_S189_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s189-index-ACGACTTG-CCACTAAGNNNN-31w_S189_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s189-index-ACGACTTG-CCACTAAGNNNN-31w_S189_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t68876 reads          \t16977054 bases\n",
      "Output:                 \t68876 reads (100.00%) \t16977054 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.667 seconds.\n",
      "Reads Processed:       68876 \t103.33k reads/sec\n",
      "Bases Processed:      16977k \t25.47m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s190-index-GCATACAG-CCACTAAGNNNN-32w_S190_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s190-index-GCATACAG-CCACTAAGNNNN-32w_S190_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s190-index-GCATACAG-CCACTAAGNNNN-32w_S190_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s190-index-GCATACAG-CCACTAAGNNNN-32w_S190_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t34952 reads          \t8574381 bases\n",
      "Output:                 \t34952 reads (100.00%) \t8574381 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.520 seconds.\n",
      "Reads Processed:       34952 \t67.19k reads/sec\n",
      "Bases Processed:       8574k \t16.48m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s191-index-TGCGAACT-CCACTAAGNNNN-35w_S191_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s191-index-TGCGAACT-CCACTAAGNNNN-35w_S191_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s191-index-TGCGAACT-CCACTAAGNNNN-35w_S191_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s191-index-TGCGAACT-CCACTAAGNNNN-35w_S191_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t32858 reads          \t7828477 bases\n",
      "Output:                 \t32858 reads (100.00%) \t7828477 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.493 seconds.\n",
      "Reads Processed:       32858 \t66.69k reads/sec\n",
      "Bases Processed:       7828k \t15.89m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s192-index-TCTCCGAT-CCACTAAGNNNN-36w_S192_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s192-index-TCTCCGAT-CCACTAAGNNNN-36w_S192_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s192-index-TCTCCGAT-CCACTAAGNNNN-36w_S192_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s192-index-TCTCCGAT-CCACTAAGNNNN-36w_S192_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t40056 reads          \t9917635 bases\n",
      "Output:                 \t40056 reads (100.00%) \t9917635 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.346 seconds.\n",
      "Reads Processed:       40056 \t115.64k reads/sec\n",
      "Bases Processed:       9917k \t28.63m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s193-index-GAGGACTT-CCACTAAGNNNN-37w_S193_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s193-index-GAGGACTT-CCACTAAGNNNN-37w_S193_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s193-index-GAGGACTT-CCACTAAGNNNN-37w_S193_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s193-index-GAGGACTT-CCACTAAGNNNN-37w_S193_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t55535 reads          \t13779964 bases\n",
      "Output:                 \t55535 reads (100.00%) \t13779964 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.453 seconds.\n",
      "Reads Processed:       55535 \t122.64k reads/sec\n",
      "Bases Processed:      13779k \t30.43m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s194-index-ACCATCCA-CCACTAAGNNNN-38w_S194_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s194-index-ACCATCCA-CCACTAAGNNNN-38w_S194_L001.fasta fastawrap=0\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Executing jgi.ReformatReads [in=lane1-s194-index-ACCATCCA-CCACTAAGNNNN-38w_S194_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s194-index-ACCATCCA-CCACTAAGNNNN-38w_S194_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t36142 reads          \t9145609 bases\n",
      "Output:                 \t36142 reads (100.00%) \t9145609 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.317 seconds.\n",
      "Reads Processed:       36142 \t113.86k reads/sec\n",
      "Bases Processed:       9145k \t28.81m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s195-index-CAACACCT-CCACTAAGNNNN-39w_S195_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s195-index-CAACACCT-CCACTAAGNNNN-39w_S195_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s195-index-CAACACCT-CCACTAAGNNNN-39w_S195_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s195-index-CAACACCT-CCACTAAGNNNN-39w_S195_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t53459 reads          \t12626651 bases\n",
      "Output:                 \t53459 reads (100.00%) \t12626651 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.379 seconds.\n",
      "Reads Processed:       53459 \t141.19k reads/sec\n",
      "Bases Processed:      12626k \t33.35m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s196-index-CTAGGTGA-TGTTCCGTNNNN-42w_S196_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s196-index-CTAGGTGA-TGTTCCGTNNNN-42w_S196_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s196-index-CTAGGTGA-TGTTCCGTNNNN-42w_S196_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s196-index-CTAGGTGA-TGTTCCGTNNNN-42w_S196_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t42947 reads          \t10600505 bases\n",
      "Output:                 \t42947 reads (100.00%) \t10600505 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.376 seconds.\n",
      "Reads Processed:       42947 \t114.09k reads/sec\n",
      "Bases Processed:      10600k \t28.16m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s197-index-ACGACTTG-TGTTCCGTNNNN-45w_S197_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s197-index-ACGACTTG-TGTTCCGTNNNN-45w_S197_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s197-index-ACGACTTG-TGTTCCGTNNNN-45w_S197_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s197-index-ACGACTTG-TGTTCCGTNNNN-45w_S197_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t20785 reads          \t4887387 bases\n",
      "Output:                 \t20785 reads (100.00%) \t4887387 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.465 seconds.\n",
      "Reads Processed:       20785 \t44.70k reads/sec\n",
      "Bases Processed:       4887k \t10.51m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s198-index-GCATACAG-TGTTCCGTNNNN-46w_S198_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s198-index-GCATACAG-TGTTCCGTNNNN-46w_S198_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s198-index-GCATACAG-TGTTCCGTNNNN-46w_S198_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s198-index-GCATACAG-TGTTCCGTNNNN-46w_S198_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t40003 reads          \t9918210 bases\n",
      "Output:                 \t40003 reads (100.00%) \t9918210 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.552 seconds.\n",
      "Reads Processed:       40003 \t72.50k reads/sec\n",
      "Bases Processed:       9918k \t17.98m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s199-index-TGCGAACT-TGTTCCGTNNNN-49w_S199_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s199-index-TGCGAACT-TGTTCCGTNNNN-49w_S199_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s199-index-TGCGAACT-TGTTCCGTNNNN-49w_S199_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s199-index-TGCGAACT-TGTTCCGTNNNN-49w_S199_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t32744 reads          \t8114086 bases\n",
      "Output:                 \t32744 reads (100.00%) \t8114086 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.341 seconds.\n",
      "Reads Processed:       32744 \t96.00k reads/sec\n",
      "Bases Processed:       8114k \t23.79m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s200-index-TCTCCGAT-TGTTCCGTNNNN-50w_S200_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s200-index-TCTCCGAT-TGTTCCGTNNNN-50w_S200_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s200-index-TCTCCGAT-TGTTCCGTNNNN-50w_S200_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s200-index-TCTCCGAT-TGTTCCGTNNNN-50w_S200_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t64561 reads          \t15098028 bases\n",
      "Output:                 \t64561 reads (100.00%) \t15098028 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.785 seconds.\n",
      "Reads Processed:       64561 \t82.24k reads/sec\n",
      "Bases Processed:      15098k \t19.23m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s201-index-GAGGACTT-TGTTCCGTNNNN-52w_S201_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s201-index-GAGGACTT-TGTTCCGTNNNN-52w_S201_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s201-index-GAGGACTT-TGTTCCGTNNNN-52w_S201_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s201-index-GAGGACTT-TGTTCCGTNNNN-52w_S201_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t30722 reads          \t7780545 bases\n",
      "Output:                 \t30722 reads (100.00%) \t7780545 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.303 seconds.\n",
      "Reads Processed:       30722 \t101.47k reads/sec\n",
      "Bases Processed:       7780k \t25.70m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s202-index-ACCATCCA-TGTTCCGTNNNN-55w_S202_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s202-index-ACCATCCA-TGTTCCGTNNNN-55w_S202_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s202-index-ACCATCCA-TGTTCCGTNNNN-55w_S202_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s202-index-ACCATCCA-TGTTCCGTNNNN-55w_S202_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t34837 reads          \t8267255 bases\n",
      "Output:                 \t34837 reads (100.00%) \t8267255 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.320 seconds.\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Reads Processed:       34837 \t108.75k reads/sec\n",
      "Bases Processed:       8267k \t25.81m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s203-index-CAACACCT-TGTTCCGTNNNN-56w_S203_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s203-index-CAACACCT-TGTTCCGTNNNN-56w_S203_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s203-index-CAACACCT-TGTTCCGTNNNN-56w_S203_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s203-index-CAACACCT-TGTTCCGTNNNN-56w_S203_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t43974 reads          \t10301118 bases\n",
      "Output:                 \t43974 reads (100.00%) \t10301118 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.373 seconds.\n",
      "Reads Processed:       43974 \t117.90k reads/sec\n",
      "Bases Processed:      10301k \t27.62m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s204-index-CTAGGTGA-GATACCTGNNNN-57w_S204_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s204-index-CTAGGTGA-GATACCTGNNNN-57w_S204_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s204-index-CTAGGTGA-GATACCTGNNNN-57w_S204_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s204-index-CTAGGTGA-GATACCTGNNNN-57w_S204_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t38789 reads          \t8938472 bases\n",
      "Output:                 \t38789 reads (100.00%) \t8938472 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.339 seconds.\n",
      "Reads Processed:       38789 \t114.32k reads/sec\n",
      "Bases Processed:       8938k \t26.34m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s205-index-ACGACTTG-GATACCTGNNNN-58w_S205_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s205-index-ACGACTTG-GATACCTGNNNN-58w_S205_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s205-index-ACGACTTG-GATACCTGNNNN-58w_S205_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s205-index-ACGACTTG-GATACCTGNNNN-58w_S205_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t56706 reads          \t13264989 bases\n",
      "Output:                 \t56706 reads (100.00%) \t13264989 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.479 seconds.\n",
      "Reads Processed:       56706 \t118.45k reads/sec\n",
      "Bases Processed:      13264k \t27.71m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s206-index-GCATACAG-GATACCTGNNNN-59w_S206_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s206-index-GCATACAG-GATACCTGNNNN-59w_S206_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s206-index-GCATACAG-GATACCTGNNNN-59w_S206_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s206-index-GCATACAG-GATACCTGNNNN-59w_S206_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t35412 reads          \t8545801 bases\n",
      "Output:                 \t35412 reads (100.00%) \t8545801 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.351 seconds.\n",
      "Reads Processed:       35412 \t100.92k reads/sec\n",
      "Bases Processed:       8545k \t24.35m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s207-index-TGCGAACT-GATACCTGNNNN-60w_S207_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s207-index-TGCGAACT-GATACCTGNNNN-60w_S207_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s207-index-TGCGAACT-GATACCTGNNNN-60w_S207_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s207-index-TGCGAACT-GATACCTGNNNN-60w_S207_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t38176 reads          \t9956923 bases\n",
      "Output:                 \t38176 reads (100.00%) \t9956923 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.344 seconds.\n",
      "Reads Processed:       38176 \t110.88k reads/sec\n",
      "Bases Processed:       9956k \t28.92m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s208-index-TCTCCGAT-GATACCTGNNNN-61w_S208_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s208-index-TCTCCGAT-GATACCTGNNNN-61w_S208_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s208-index-TCTCCGAT-GATACCTGNNNN-61w_S208_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s208-index-TCTCCGAT-GATACCTGNNNN-61w_S208_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t45202 reads          \t10624141 bases\n",
      "Output:                 \t45202 reads (100.00%) \t10624141 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.374 seconds.\n",
      "Reads Processed:       45202 \t120.96k reads/sec\n",
      "Bases Processed:      10624k \t28.43m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s209-index-GAGGACTT-GATACCTGNNNN-64w_S209_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s209-index-GAGGACTT-GATACCTGNNNN-64w_S209_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s209-index-GAGGACTT-GATACCTGNNNN-64w_S209_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s209-index-GAGGACTT-GATACCTGNNNN-64w_S209_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t52038 reads          \t12955860 bases\n",
      "Output:                 \t52038 reads (100.00%) \t12955860 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.644 seconds.\n",
      "Reads Processed:       52038 \t80.81k reads/sec\n",
      "Bases Processed:      12955k \t20.12m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s210-index-ACCATCCA-GATACCTGNNNN-66w_S210_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s210-index-ACCATCCA-GATACCTGNNNN-66w_S210_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s210-index-ACCATCCA-GATACCTGNNNN-66w_S210_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s210-index-ACCATCCA-GATACCTGNNNN-66w_S210_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t23127 reads          \t5261867 bases\n",
      "Output:                 \t23127 reads (100.00%) \t5261867 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.451 seconds.\n",
      "Reads Processed:       23127 \t51.25k reads/sec\n",
      "Bases Processed:       5261k \t11.66m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s211-index-CAACACCT-GATACCTGNNNN-67w_S211_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s211-index-CAACACCT-GATACCTGNNNN-67w_S211_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s211-index-CAACACCT-GATACCTGNNNN-67w_S211_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s211-index-CAACACCT-GATACCTGNNNN-67w_S211_L001.fasta, fastawrap=0]\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t8913 reads          \t2016016 bases\n",
      "Output:                 \t8913 reads (100.00%) \t2016016 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.234 seconds.\n",
      "Reads Processed:        8913 \t38.04k reads/sec\n",
      "Bases Processed:       2016k \t8.60m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s212-index-CTAGGTGA-AGCCGTAANNNN-68w_S212_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s212-index-CTAGGTGA-AGCCGTAANNNN-68w_S212_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s212-index-CTAGGTGA-AGCCGTAANNNN-68w_S212_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s212-index-CTAGGTGA-AGCCGTAANNNN-68w_S212_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t42053 reads          \t11038090 bases\n",
      "Output:                 \t42053 reads (100.00%) \t11038090 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.346 seconds.\n",
      "Reads Processed:       42053 \t121.66k reads/sec\n",
      "Bases Processed:      11038k \t31.93m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s213-index-ACGACTTG-AGCCGTAANNNN-69w_S213_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s213-index-ACGACTTG-AGCCGTAANNNN-69w_S213_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s213-index-ACGACTTG-AGCCGTAANNNN-69w_S213_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s213-index-ACGACTTG-AGCCGTAANNNN-69w_S213_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t38085 reads          \t8622167 bases\n",
      "Output:                 \t38085 reads (100.00%) \t8622167 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.356 seconds.\n",
      "Reads Processed:       38085 \t107.00k reads/sec\n",
      "Bases Processed:       8622k \t24.22m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s214-index-GCATACAG-AGCCGTAANNNN-70w_S214_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s214-index-GCATACAG-AGCCGTAANNNN-70w_S214_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s214-index-GCATACAG-AGCCGTAANNNN-70w_S214_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s214-index-GCATACAG-AGCCGTAANNNN-70w_S214_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t34443 reads          \t8401218 bases\n",
      "Output:                 \t34443 reads (100.00%) \t8401218 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.304 seconds.\n",
      "Reads Processed:       34443 \t113.15k reads/sec\n",
      "Bases Processed:       8401k \t27.60m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s215-index-TGCGAACT-AGCCGTAANNNN-71w_S215_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s215-index-TGCGAACT-AGCCGTAANNNN-71w_S215_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s215-index-TGCGAACT-AGCCGTAANNNN-71w_S215_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s215-index-TGCGAACT-AGCCGTAANNNN-71w_S215_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t42640 reads          \t11107641 bases\n",
      "Output:                 \t42640 reads (100.00%) \t11107641 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.359 seconds.\n",
      "Reads Processed:       42640 \t118.91k reads/sec\n",
      "Bases Processed:      11107k \t30.98m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s216-index-TCTCCGAT-AGCCGTAANNNN-72w_S216_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s216-index-TCTCCGAT-AGCCGTAANNNN-72w_S216_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s216-index-TCTCCGAT-AGCCGTAANNNN-72w_S216_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s216-index-TCTCCGAT-AGCCGTAANNNN-72w_S216_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t44885 reads          \t11539491 bases\n",
      "Output:                 \t44885 reads (100.00%) \t11539491 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.346 seconds.\n",
      "Reads Processed:       44885 \t129.57k reads/sec\n",
      "Bases Processed:      11539k \t33.31m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s217-index-GAGGACTT-AGCCGTAANNNN-73w_S217_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s217-index-GAGGACTT-AGCCGTAANNNN-73w_S217_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s217-index-GAGGACTT-AGCCGTAANNNN-73w_S217_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s217-index-GAGGACTT-AGCCGTAANNNN-73w_S217_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t43172 reads          \t10709359 bases\n",
      "Output:                 \t43172 reads (100.00%) \t10709359 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.348 seconds.\n",
      "Reads Processed:       43172 \t124.12k reads/sec\n",
      "Bases Processed:      10709k \t30.79m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s218-index-ACCATCCA-AGCCGTAANNNN-74w_S218_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s218-index-ACCATCCA-AGCCGTAANNNN-74w_S218_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s218-index-ACCATCCA-AGCCGTAANNNN-74w_S218_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s218-index-ACCATCCA-AGCCGTAANNNN-74w_S218_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t61181 reads          \t14339075 bases\n",
      "Output:                 \t61181 reads (100.00%) \t14339075 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.726 seconds.\n",
      "Reads Processed:       61181 \t84.31k reads/sec\n",
      "Bases Processed:      14339k \t19.76m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s219-index-CAACACCT-AGCCGTAANNNN-75w_S219_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s219-index-CAACACCT-AGCCGTAANNNN-75w_S219_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s219-index-CAACACCT-AGCCGTAANNNN-75w_S219_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s219-index-CAACACCT-AGCCGTAANNNN-75w_S219_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t24691 reads          \t5951693 bases\n",
      "Output:                 \t24691 reads (100.00%) \t5951693 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.479 seconds.\n",
      "Reads Processed:       24691 \t51.54k reads/sec\n",
      "Bases Processed:       5951k \t12.42m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s220-index-CTAGGTGA-CTCCTGAANNNN-76w_S220_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s220-index-CTAGGTGA-CTCCTGAANNNN-76w_S220_L001.fasta fastawrap=0\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Executing jgi.ReformatReads [in=lane1-s220-index-CTAGGTGA-CTCCTGAANNNN-76w_S220_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s220-index-CTAGGTGA-CTCCTGAANNNN-76w_S220_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t42984 reads          \t11182364 bases\n",
      "Output:                 \t42984 reads (100.00%) \t11182364 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.371 seconds.\n",
      "Reads Processed:       42984 \t115.80k reads/sec\n",
      "Bases Processed:      11182k \t30.13m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s221-index-ACGACTTG-CTCCTGAANNNN-79w_S221_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s221-index-ACGACTTG-CTCCTGAANNNN-79w_S221_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s221-index-ACGACTTG-CTCCTGAANNNN-79w_S221_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s221-index-ACGACTTG-CTCCTGAANNNN-79w_S221_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t50505 reads          \t12091847 bases\n",
      "Output:                 \t50505 reads (100.00%) \t12091847 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.386 seconds.\n",
      "Reads Processed:       50505 \t130.67k reads/sec\n",
      "Bases Processed:      12091k \t31.29m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s222-index-GCATACAG-CTCCTGAANNNN-81w_S222_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s222-index-GCATACAG-CTCCTGAANNNN-81w_S222_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s222-index-GCATACAG-CTCCTGAANNNN-81w_S222_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s222-index-GCATACAG-CTCCTGAANNNN-81w_S222_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t49211 reads          \t11893193 bases\n",
      "Output:                 \t49211 reads (100.00%) \t11893193 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.385 seconds.\n",
      "Reads Processed:       49211 \t127.66k reads/sec\n",
      "Bases Processed:      11893k \t30.85m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s223-index-TGCGAACT-CTCCTGAANNNN-82w_S223_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s223-index-TGCGAACT-CTCCTGAANNNN-82w_S223_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s223-index-TGCGAACT-CTCCTGAANNNN-82w_S223_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s223-index-TGCGAACT-CTCCTGAANNNN-82w_S223_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t47997 reads          \t11734415 bases\n",
      "Output:                 \t47997 reads (100.00%) \t11734415 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.404 seconds.\n",
      "Reads Processed:       47997 \t118.81k reads/sec\n",
      "Bases Processed:      11734k \t29.05m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s224-index-TCTCCGAT-CTCCTGAANNNN-84w_S224_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s224-index-TCTCCGAT-CTCCTGAANNNN-84w_S224_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s224-index-TCTCCGAT-CTCCTGAANNNN-84w_S224_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s224-index-TCTCCGAT-CTCCTGAANNNN-84w_S224_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t59336 reads          \t14685640 bases\n",
      "Output:                 \t59336 reads (100.00%) \t14685640 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.770 seconds.\n",
      "Reads Processed:       59336 \t77.10k reads/sec\n",
      "Bases Processed:      14685k \t19.08m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s225-index-GAGGACTT-CTCCTGAANNNN-85w_S225_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s225-index-GAGGACTT-CTCCTGAANNNN-85w_S225_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s225-index-GAGGACTT-CTCCTGAANNNN-85w_S225_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s225-index-GAGGACTT-CTCCTGAANNNN-85w_S225_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t41299 reads          \t9815193 bases\n",
      "Output:                 \t41299 reads (100.00%) \t9815193 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.350 seconds.\n",
      "Reads Processed:       41299 \t117.92k reads/sec\n",
      "Bases Processed:       9815k \t28.02m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s226-index-ACCATCCA-CTCCTGAANNNN-86w_S226_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s226-index-ACCATCCA-CTCCTGAANNNN-86w_S226_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s226-index-ACCATCCA-CTCCTGAANNNN-86w_S226_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s226-index-ACCATCCA-CTCCTGAANNNN-86w_S226_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t30271 reads          \t7521534 bases\n",
      "Output:                 \t30271 reads (100.00%) \t7521534 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.297 seconds.\n",
      "Reads Processed:       30271 \t101.84k reads/sec\n",
      "Bases Processed:       7521k \t25.30m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s227-index-CAACACCT-CTCCTGAANNNN-87w_S227_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s227-index-CAACACCT-CTCCTGAANNNN-87w_S227_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s227-index-CAACACCT-CTCCTGAANNNN-87w_S227_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s227-index-CAACACCT-CTCCTGAANNNN-87w_S227_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t25083 reads          \t6552514 bases\n",
      "Output:                 \t25083 reads (100.00%) \t6552514 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.488 seconds.\n",
      "Reads Processed:       25083 \t51.38k reads/sec\n",
      "Bases Processed:       6552k \t13.42m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s228-index-CTAGGTGA-ACGAATCCNNNN-88w_S228_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s228-index-CTAGGTGA-ACGAATCCNNNN-88w_S228_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s228-index-CTAGGTGA-ACGAATCCNNNN-88w_S228_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s228-index-CTAGGTGA-ACGAATCCNNNN-88w_S228_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t62721 reads          \t16050391 bases\n",
      "Output:                 \t62721 reads (100.00%) \t16050391 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.448 seconds.\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Reads Processed:       62721 \t139.92k reads/sec\n",
      "Bases Processed:      16050k \t35.81m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s229-index-ACGACTTG-ACGAATCCNNNN-89w_S229_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s229-index-ACGACTTG-ACGAATCCNNNN-89w_S229_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s229-index-ACGACTTG-ACGAATCCNNNN-89w_S229_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s229-index-ACGACTTG-ACGAATCCNNNN-89w_S229_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t49122 reads          \t12916117 bases\n",
      "Output:                 \t49122 reads (100.00%) \t12916117 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.389 seconds.\n",
      "Reads Processed:       49122 \t126.30k reads/sec\n",
      "Bases Processed:      12916k \t33.21m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s230-index-GCATACAG-ACGAATCCNNNN-92w_S230_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s230-index-GCATACAG-ACGAATCCNNNN-92w_S230_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s230-index-GCATACAG-ACGAATCCNNNN-92w_S230_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s230-index-GCATACAG-ACGAATCCNNNN-92w_S230_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t44144 reads          \t10963508 bases\n",
      "Output:                 \t44144 reads (100.00%) \t10963508 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.374 seconds.\n",
      "Reads Processed:       44144 \t117.89k reads/sec\n",
      "Bases Processed:      10963k \t29.28m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s231-index-TGCGAACT-ACGAATCCNNNN-93w_S231_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s231-index-TGCGAACT-ACGAATCCNNNN-93w_S231_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s231-index-TGCGAACT-ACGAATCCNNNN-93w_S231_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s231-index-TGCGAACT-ACGAATCCNNNN-93w_S231_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t37202 reads          \t9266267 bases\n",
      "Output:                 \t37202 reads (100.00%) \t9266267 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.546 seconds.\n",
      "Reads Processed:       37202 \t68.18k reads/sec\n",
      "Bases Processed:       9266k \t16.98m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s232-index-TCTCCGAT-ACGAATCCNNNN-94w_S232_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s232-index-TCTCCGAT-ACGAATCCNNNN-94w_S232_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s232-index-TCTCCGAT-ACGAATCCNNNN-94w_S232_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s232-index-TCTCCGAT-ACGAATCCNNNN-94w_S232_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t26731 reads          \t6784289 bases\n",
      "Output:                 \t26731 reads (100.00%) \t6784289 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.293 seconds.\n",
      "Reads Processed:       26731 \t91.11k reads/sec\n",
      "Bases Processed:       6784k \t23.12m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s233-index-GAGGACTT-ACGAATCCNNNN-95w_S233_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s233-index-GAGGACTT-ACGAATCCNNNN-95w_S233_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s233-index-GAGGACTT-ACGAATCCNNNN-95w_S233_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s233-index-GAGGACTT-ACGAATCCNNNN-95w_S233_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t10641 reads          \t3037417 bases\n",
      "Output:                 \t10641 reads (100.00%) \t3037417 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.430 seconds.\n",
      "Reads Processed:       10641 \t24.75k reads/sec\n",
      "Bases Processed:       3037k \t7.07m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s234-index-ACCATCCA-ACGAATCCNNNN-96w_S234_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s234-index-ACCATCCA-ACGAATCCNNNN-96w_S234_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s234-index-ACCATCCA-ACGAATCCNNNN-96w_S234_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s234-index-ACCATCCA-ACGAATCCNNNN-96w_S234_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t21248 reads          \t5464274 bases\n",
      "Output:                 \t21248 reads (100.00%) \t5464274 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.271 seconds.\n",
      "Reads Processed:       21248 \t78.39k reads/sec\n",
      "Bases Processed:       5464k \t20.16m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s235-index-CAACACCT-ACGAATCCNNNN-97w_S235_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s235-index-CAACACCT-ACGAATCCNNNN-97w_S235_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s235-index-CAACACCT-ACGAATCCNNNN-97w_S235_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s235-index-CAACACCT-ACGAATCCNNNN-97w_S235_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t23268 reads          \t5679623 bases\n",
      "Output:                 \t23268 reads (100.00%) \t5679623 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.474 seconds.\n",
      "Reads Processed:       23268 \t49.11k reads/sec\n",
      "Bases Processed:       5679k \t11.99m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s236-index-CTAGGTGA-AATGGTCGNNNN-99w_S236_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s236-index-CTAGGTGA-AATGGTCGNNNN-99w_S236_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s236-index-CTAGGTGA-AATGGTCGNNNN-99w_S236_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s236-index-CTAGGTGA-AATGGTCGNNNN-99w_S236_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t24908 reads          \t6003207 bases\n",
      "Output:                 \t24908 reads (100.00%) \t6003207 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.271 seconds.\n",
      "Reads Processed:       24908 \t91.87k reads/sec\n",
      "Bases Processed:       6003k \t22.14m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s237-index-ACGACTTG-AATGGTCGNNNN-100w_S237_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s237-index-ACGACTTG-AATGGTCGNNNN-100w_S237_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s237-index-ACGACTTG-AATGGTCGNNNN-100w_S237_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s237-index-ACGACTTG-AATGGTCGNNNN-100w_S237_L001.fasta, fastawrap=0]\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t24703 reads          \t6149228 bases\n",
      "Output:                 \t24703 reads (100.00%) \t6149228 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.278 seconds.\n",
      "Reads Processed:       24703 \t88.84k reads/sec\n",
      "Bases Processed:       6149k \t22.12m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s238-index-GCATACAG-AATGGTCGNNNN-101w_S238_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s238-index-GCATACAG-AATGGTCGNNNN-101w_S238_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s238-index-GCATACAG-AATGGTCGNNNN-101w_S238_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s238-index-GCATACAG-AATGGTCGNNNN-101w_S238_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t35091 reads          \t8719762 bases\n",
      "Output:                 \t35091 reads (100.00%) \t8719762 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.320 seconds.\n",
      "Reads Processed:       35091 \t109.55k reads/sec\n",
      "Bases Processed:       8719k \t27.22m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s239-index-TGCGAACT-AATGGTCGNNNN-102w_S239_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s239-index-TGCGAACT-AATGGTCGNNNN-102w_S239_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s239-index-TGCGAACT-AATGGTCGNNNN-102w_S239_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s239-index-TGCGAACT-AATGGTCGNNNN-102w_S239_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t26224 reads          \t6819140 bases\n",
      "Output:                 \t26224 reads (100.00%) \t6819140 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.296 seconds.\n",
      "Reads Processed:       26224 \t88.73k reads/sec\n",
      "Bases Processed:       6819k \t23.07m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s240-index-TCTCCGAT-AATGGTCGNNNN-104w_S240_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s240-index-TCTCCGAT-AATGGTCGNNNN-104w_S240_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s240-index-TCTCCGAT-AATGGTCGNNNN-104w_S240_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s240-index-TCTCCGAT-AATGGTCGNNNN-104w_S240_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t36597 reads          \t9471889 bases\n",
      "Output:                 \t36597 reads (100.00%) \t9471889 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.359 seconds.\n",
      "Reads Processed:       36597 \t101.99k reads/sec\n",
      "Bases Processed:       9471k \t26.40m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s241-index-GAGGACTT-AATGGTCGNNNN-106w_S241_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s241-index-GAGGACTT-AATGGTCGNNNN-106w_S241_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s241-index-GAGGACTT-AATGGTCGNNNN-106w_S241_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s241-index-GAGGACTT-AATGGTCGNNNN-106w_S241_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t18100 reads          \t4518090 bases\n",
      "Output:                 \t18100 reads (100.00%) \t4518090 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.251 seconds.\n",
      "Reads Processed:       18100 \t72.02k reads/sec\n",
      "Bases Processed:       4518k \t17.98m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s242-index-ACCATCCA-AATGGTCGNNNN-107w_S242_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s242-index-ACCATCCA-AATGGTCGNNNN-107w_S242_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s242-index-ACCATCCA-AATGGTCGNNNN-107w_S242_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s242-index-ACCATCCA-AATGGTCGNNNN-107w_S242_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t18552 reads          \t5196874 bases\n",
      "Output:                 \t18552 reads (100.00%) \t5196874 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.456 seconds.\n",
      "Reads Processed:       18552 \t40.65k reads/sec\n",
      "Bases Processed:       5196k \t11.39m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s243-index-CAACACCT-AATGGTCGNNNN-108w_S243_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s243-index-CAACACCT-AATGGTCGNNNN-108w_S243_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s243-index-CAACACCT-AATGGTCGNNNN-108w_S243_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s243-index-CAACACCT-AATGGTCGNNNN-108w_S243_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t29723 reads          \t8509437 bases\n",
      "Output:                 \t29723 reads (100.00%) \t8509437 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.308 seconds.\n",
      "Reads Processed:       29723 \t96.41k reads/sec\n",
      "Bases Processed:       8509k \t27.60m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s244-index-CTAGGTGA-CGCTACATNNNN-109w_S244_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s244-index-CTAGGTGA-CGCTACATNNNN-109w_S244_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s244-index-CTAGGTGA-CGCTACATNNNN-109w_S244_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s244-index-CTAGGTGA-CGCTACATNNNN-109w_S244_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t29872 reads          \t7567558 bases\n",
      "Output:                 \t29872 reads (100.00%) \t7567558 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.305 seconds.\n",
      "Reads Processed:       29872 \t97.83k reads/sec\n",
      "Bases Processed:       7567k \t24.78m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s245-index-ACGACTTG-CGCTACATNNNN-114w_S245_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s245-index-ACGACTTG-CGCTACATNNNN-114w_S245_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s245-index-ACGACTTG-CGCTACATNNNN-114w_S245_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s245-index-ACGACTTG-CGCTACATNNNN-114w_S245_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t21261 reads          \t5458254 bases\n",
      "Output:                 \t21261 reads (100.00%) \t5458254 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.270 seconds.\n",
      "Reads Processed:       21261 \t78.76k reads/sec\n",
      "Bases Processed:       5458k \t20.22m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s246-index-GCATACAG-CGCTACATNNNN-115w_S246_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s246-index-GCATACAG-CGCTACATNNNN-115w_S246_L001.fasta fastawrap=0\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Executing jgi.ReformatReads [in=lane1-s246-index-GCATACAG-CGCTACATNNNN-115w_S246_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s246-index-GCATACAG-CGCTACATNNNN-115w_S246_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t30651 reads          \t7604374 bases\n",
      "Output:                 \t30651 reads (100.00%) \t7604374 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.331 seconds.\n",
      "Reads Processed:       30651 \t92.52k reads/sec\n",
      "Bases Processed:       7604k \t22.96m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s247-index-TGCGAACT-CGCTACATNNNN-121w_S247_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s247-index-TGCGAACT-CGCTACATNNNN-121w_S247_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s247-index-TGCGAACT-CGCTACATNNNN-121w_S247_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s247-index-TGCGAACT-CGCTACATNNNN-121w_S247_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t47719 reads          \t13825315 bases\n",
      "Output:                 \t47719 reads (100.00%) \t13825315 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.448 seconds.\n",
      "Reads Processed:       47719 \t106.50k reads/sec\n",
      "Bases Processed:      13825k \t30.85m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s248-index-TCTCCGAT-CGCTACATNNNN-124w_S248_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s248-index-TCTCCGAT-CGCTACATNNNN-124w_S248_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s248-index-TCTCCGAT-CGCTACATNNNN-124w_S248_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s248-index-TCTCCGAT-CGCTACATNNNN-124w_S248_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t35793 reads          \t8767687 bases\n",
      "Output:                 \t35793 reads (100.00%) \t8767687 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.343 seconds.\n",
      "Reads Processed:       35793 \t104.40k reads/sec\n",
      "Bases Processed:       8767k \t25.57m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s249-index-GAGGACTT-CGCTACATNNNN-125w_S249_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s249-index-GAGGACTT-CGCTACATNNNN-125w_S249_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s249-index-GAGGACTT-CGCTACATNNNN-125w_S249_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s249-index-GAGGACTT-CGCTACATNNNN-125w_S249_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t44891 reads          \t10664168 bases\n",
      "Output:                 \t44891 reads (100.00%) \t10664168 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.563 seconds.\n",
      "Reads Processed:       44891 \t79.69k reads/sec\n",
      "Bases Processed:      10664k \t18.93m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s250-index-ACCATCCA-CGCTACATNNNN-128w_S250_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s250-index-ACCATCCA-CGCTACATNNNN-128w_S250_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s250-index-ACCATCCA-CGCTACATNNNN-128w_S250_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s250-index-ACCATCCA-CGCTACATNNNN-128w_S250_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t48829 reads          \t12922422 bases\n",
      "Output:                 \t48829 reads (100.00%) \t12922422 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.630 seconds.\n",
      "Reads Processed:       48829 \t77.47k reads/sec\n",
      "Bases Processed:      12922k \t20.50m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s251-index-CAACACCT-CGCTACATNNNN-129w_S251_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s251-index-CAACACCT-CGCTACATNNNN-129w_S251_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s251-index-CAACACCT-CGCTACATNNNN-129w_S251_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s251-index-CAACACCT-CGCTACATNNNN-129w_S251_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t36013 reads          \t8829441 bases\n",
      "Output:                 \t36013 reads (100.00%) \t8829441 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.534 seconds.\n",
      "Reads Processed:       36013 \t67.44k reads/sec\n",
      "Bases Processed:       8829k \t16.54m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s252-index-CTAGGTGA-CCTAAGTCNNNN-130w_S252_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s252-index-CTAGGTGA-CCTAAGTCNNNN-130w_S252_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s252-index-CTAGGTGA-CCTAAGTCNNNN-130w_S252_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s252-index-CTAGGTGA-CCTAAGTCNNNN-130w_S252_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t18551 reads          \t4500023 bases\n",
      "Output:                 \t18551 reads (100.00%) \t4500023 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.271 seconds.\n",
      "Reads Processed:       18551 \t68.48k reads/sec\n",
      "Bases Processed:       4500k \t16.61m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s253-index-ACGACTTG-CCTAAGTCNNNN-131w_S253_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s253-index-ACGACTTG-CCTAAGTCNNNN-131w_S253_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s253-index-ACGACTTG-CCTAAGTCNNNN-131w_S253_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s253-index-ACGACTTG-CCTAAGTCNNNN-131w_S253_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t31741 reads          \t7315738 bases\n",
      "Output:                 \t31741 reads (100.00%) \t7315738 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.297 seconds.\n",
      "Reads Processed:       31741 \t106.96k reads/sec\n",
      "Bases Processed:       7315k \t24.65m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s254-index-GCATACAG-CCTAAGTCNNNN-133w_S254_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s254-index-GCATACAG-CCTAAGTCNNNN-133w_S254_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s254-index-GCATACAG-CCTAAGTCNNNN-133w_S254_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s254-index-GCATACAG-CCTAAGTCNNNN-133w_S254_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t37523 reads          \t9979333 bases\n",
      "Output:                 \t37523 reads (100.00%) \t9979333 bases (100.00%)\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "\n",
      "Time:                         \t0.560 seconds.\n",
      "Reads Processed:       37523 \t67.01k reads/sec\n",
      "Bases Processed:       9979k \t17.82m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s255-index-TGCGAACT-CCTAAGTCNNNN-Neg_S255_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s255-index-TGCGAACT-CCTAAGTCNNNN-Neg_S255_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s255-index-TGCGAACT-CCTAAGTCNNNN-Neg_S255_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s255-index-TGCGAACT-CCTAAGTCNNNN-Neg_S255_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t1514 reads          \t371147 bases\n",
      "Output:                 \t1514 reads (100.00%) \t371147 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.156 seconds.\n",
      "Reads Processed:        1514 \t9.72k reads/sec\n",
      "Bases Processed:        371k \t2.38m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s256-index-TCTCCGAT-CCTAAGTCNNNN-PosG_S256_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s256-index-TCTCCGAT-CCTAAGTCNNNN-PosG_S256_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s256-index-TCTCCGAT-CCTAAGTCNNNN-PosG_S256_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s256-index-TCTCCGAT-CCTAAGTCNNNN-PosG_S256_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t60280 reads          \t15209056 bases\n",
      "Output:                 \t60280 reads (100.00%) \t15209056 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.415 seconds.\n",
      "Reads Processed:       60280 \t145.29k reads/sec\n",
      "Bases Processed:      15209k \t36.66m bases/sec\n",
      "java -ea -Xmx200m -cp /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/bbmap/current/ jgi.ReformatReads in=lane1-s257-index-GAGGACTT-CCTAAGTCNNNN-PosI_S257_L001_R1_trimmed.merge.filt.fastq out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s257-index-GAGGACTT-CCTAAGTCNNNN-PosI_S257_L001.fasta fastawrap=0\n",
      "Executing jgi.ReformatReads [in=lane1-s257-index-GAGGACTT-CCTAAGTCNNNN-PosI_S257_L001_R1_trimmed.merge.filt.fastq, out=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta/lane1-s257-index-GAGGACTT-CCTAAGTCNNNN-PosI_S257_L001.fasta, fastawrap=0]\n",
      "\n",
      "Input is being processed as unpaired\n",
      "Input:                  \t40424 reads          \t10530033 bases\n",
      "Output:                 \t40424 reads (100.00%) \t10530033 bases (100.00%)\n",
      "\n",
      "Time:                         \t0.354 seconds.\n",
      "Reads Processed:       40424 \t114.13k reads/sec\n",
      "Bases Processed:      10530k \t29.73m bases/sec\n"
     ]
    }
   ],
   "source": [
    "cat woodFastaStdout.txt"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id=\"demult\"><h3>Demultiplex leaf reads</h3></a>\n",
    "\n",
    "The leaf reads are in one massive file that needs to be taken apart and organized by the sample barcodes, which are the first 12 bps of each read, after we did [some rearranging above](#rearrange). "
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "ld=\"/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/\"\n",
    "\n",
    "(cat leaf_merged_filt.fasta | fastx_barcode_splitter.pl \\\n",
    "    --bcfile leafread_fastx_map.txt \\\n",
    "    --prefix $ld\"leaf_\"  \\\n",
    "    --suffix \".fa\"  \\\n",
    "    --bol --mismatches 1 --partial 1 \\\n",
    "    &>> \"leaf_demult_log.txt\" &) &"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 12,
   "metadata": {
    "scrolled": true
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Barcode\tCount\tLocation\n",
      "1\t237434\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_1.fa\n",
      "100\t138715\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_100.fa\n",
      "101\t117532\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_101.fa\n",
      "102\t122279\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_102.fa\n",
      "103\t58121\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_103.fa\n",
      "104\t85418\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_104.fa\n",
      "105\t35436\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_105.fa\n",
      "106\t8\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_106.fa\n",
      "107\t91405\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_107.fa\n",
      "108\t34447\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_108.fa\n",
      "109\t16078\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_109.fa\n",
      "110\t97470\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_110.fa\n",
      "111\t176379\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_111.fa\n",
      "112A\t17\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_112A.fa\n",
      "112B\t15153\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_112B.fa\n",
      "113A\t79\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_113A.fa\n",
      "113B\t24\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_113B.fa\n",
      "114\t63175\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_114.fa\n",
      "115\t145816\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_115.fa\n",
      "116\t107673\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_116.fa\n",
      "117\t73020\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_117.fa\n",
      "118\t120429\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_118.fa\n",
      "119\t87613\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_119.fa\n",
      "12\t18611\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_12.fa\n",
      "120\t35954\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_120.fa\n",
      "121\t50344\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_121.fa\n",
      "122\t66494\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_122.fa\n",
      "125\t122932\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_125.fa\n",
      "126A\t75265\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_126A.fa\n",
      "126B\t20\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_126B.fa\n",
      "127\t123273\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_127.fa\n",
      "128\t69798\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_128.fa\n",
      "129\t42561\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_129.fa\n",
      "13\t346552\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_13.fa\n",
      "130\t70599\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_130.fa\n",
      "131\t121565\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_131.fa\n",
      "132\t137293\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_132.fa\n",
      "133\t10918\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_133.fa\n",
      "14\t57967\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_14.fa\n",
      "15\t192521\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_15.fa\n",
      "16\t169740\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_16.fa\n",
      "17\t103934\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_17.fa\n",
      "18\t1656\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_18.fa\n",
      "19\t4804\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_19.fa\n",
      "2\t8645\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_2.fa\n",
      "20\t547875\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_20.fa\n",
      "21\t172240\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_21.fa\n",
      "22\t21219\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_22.fa\n",
      "23\t95314\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_23.fa\n",
      "24\t131393\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_24.fa\n",
      "25\t22896\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_25.fa\n",
      "26\t161946\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_26.fa\n",
      "27\t401675\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_27.fa\n",
      "28\t7213\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_28.fa\n",
      "29\t130629\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_29.fa\n",
      "3\t8709\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_3.fa\n",
      "30\t109846\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_30.fa\n",
      "31\t8491\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_31.fa\n",
      "32\t170684\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_32.fa\n",
      "33\t37485\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_33.fa\n",
      "34\t106527\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_34.fa\n",
      "35\t12267\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_35.fa\n",
      "36\t59826\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_36.fa\n",
      "37\t105717\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_37.fa\n",
      "38\t106485\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_38.fa\n",
      "39\t12353\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_39.fa\n",
      "4\t111806\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_4.fa\n",
      "40\t241177\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_40.fa\n",
      "41\t39377\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_41.fa\n",
      "42\t127380\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_42.fa\n",
      "43\t54950\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_43.fa\n",
      "44\t38946\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_44.fa\n",
      "45\t99072\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_45.fa\n",
      "46\t14371\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_46.fa\n",
      "47\t19917\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_47.fa\n",
      "48\t34952\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_48.fa\n",
      "49\t46266\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_49.fa\n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "5\t7887\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_5.fa\n",
      "50\t91324\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_50.fa\n",
      "51\t179957\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_51.fa\n",
      "52\t100442\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_52.fa\n",
      "53\t29372\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_53.fa\n",
      "54\t10777\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_54.fa\n",
      "55\t138725\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_55.fa\n",
      "56\t16369\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_56.fa\n",
      "57\t13611\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_57.fa\n",
      "58\t32997\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_58.fa\n",
      "59\t355512\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_59.fa\n",
      "6\t10455\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_6.fa\n",
      "60\t28137\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_60.fa\n",
      "61\t7529\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_61.fa\n",
      "62\t138036\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_62.fa\n",
      "63\t195899\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_63.fa\n",
      "64\t178597\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_64.fa\n",
      "65\t52493\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_65.fa\n",
      "66\t113943\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_66.fa\n",
      "67\t2211\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_67.fa\n",
      "68\t64911\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_68.fa\n",
      "69\t99575\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_69.fa\n",
      "7\t391532\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_7.fa\n",
      "70\t127821\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_70.fa\n",
      "71\t131544\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_71.fa\n",
      "72\t23506\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_72.fa\n",
      "73\t25386\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_73.fa\n",
      "74\t347\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_74.fa\n",
      "75\t193307\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_75.fa\n",
      "76\t10229\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_76.fa\n",
      "77\t65689\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_77.fa\n",
      "78\t322859\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_78.fa\n",
      "79\t11551\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_79.fa\n",
      "8\t7200\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_8.fa\n",
      "80\t6009\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_80.fa\n",
      "81\t179624\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_81.fa\n",
      "82\t17280\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_82.fa\n",
      "83\t36979\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_83.fa\n",
      "84\t12096\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_84.fa\n",
      "85\t110737\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_85.fa\n",
      "86\t1769\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_86.fa\n",
      "87\t17495\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_87.fa\n",
      "88\t26095\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_88.fa\n",
      "89\t6602\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_89.fa\n",
      "9\t15943\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_9.fa\n",
      "90\t129966\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_90.fa\n",
      "91\t12\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_91.fa\n",
      "92\t263893\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_92.fa\n",
      "93\t141716\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_93.fa\n",
      "94\t91439\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_94.fa\n",
      "95\t45812\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_95.fa\n",
      "96\t193815\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_96.fa\n",
      "97\t57981\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_97.fa\n",
      "98\t116966\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_98.fa\n",
      "99\t44936\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_99.fa\n",
      "NCA\t4889\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_NCA.fa\n",
      "NCB\t110534\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_NCB.fa\n",
      "unmatched\t2645675\t/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/demult/leaf_unmatched.fa\n",
      "total\t14372164\n"
     ]
    }
   ],
   "source": [
    "cat leaf_demult_log.txt"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "2,645,675 reads unmatched. That's a lot. Hmmm."
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id='clipPrimers'><h3>Clip primers</h3></a>\n",
    "\n",
    "The leaves still have primers and barcodes on them: "
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 14,
   "metadata": {},
   "outputs": [],
   "source": [
    "cd demult"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 16,
   "metadata": {
    "scrolled": false
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "87084\n",
      "CGTGATAAGACG\u001b[01;31m\u001b[KGCTGCGTTCTTCATCGATGC\u001b[m\u001b[KCAGAACCAAGAGATCCGTTGTTAAAAGTTTTAATTATTTGCTTGTGCCACTCAGAAGAGACGTCGTGTAAATAGAGTTTGGTTTCCTCCGGCGGGCGCCCCGTCCCCGTGGTGGGGGCCGGCGCCGGGAGGGGAGGCCCGCGAGAGGCTTCCCCTGCCCGCCGAAGCAACGGTTAGGTACGTTCACAAAGGGTTATAGAGCGGTAACTCAGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGACTTTTACTTCCTCTAAATNACCAAGCGTCTTATCACG\n",
      "CGTGATCAGACG\u001b[01;31m\u001b[KGCTGCGTTCTTCATCGATGC\u001b[m\u001b[KCAGAACCAAGAGATCCGTTGTTAAAAGTTTTAATTATTTGCTTGTGCCACTCAGAAGAGACGTCGTGTAAATAGAGTTTGGTTTCCTCCGGCGGGCGCCCCGTCCCCCTGGTGGGGGCCGGCGCCGGGAGGGGAGGCCCGCGAGAGGCTTCCCCTGCCCGCCGAAGCAACGGTTAGGTATGTTCACAAAGGGTTATAGAGCGGTAACTCAGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGACTCGTACTTCCTCTAAATNACCAAGCGTCTGATCACG\n",
      "CGTGATAAGACA\u001b[01;31m\u001b[KGCTGCGTTCTTCATCGATGC\u001b[m\u001b[KCAGAACCAAGAGATCCGTTGTTAAAAGTTTTGATTATTTGCTTGTACCACTCAGAAGAAACGTCGTTAAATCAGAGTTTGGTTATCCTCCGGCGGGCGCCGACCCGCCCGGGGGCGGGAGGCCGGGAGGGTCACGGAGACCCTACCCGCCGAAGCAACAGTTATAGGTATGTTCACAAAGGGTTGTAGAGCGTAAACTCAGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGACTTTTACTTCCTCTAAATNACCAAGTGTCTTATCACG\n",
      "CGTGATTAGACG\u001b[01;31m\u001b[KGCTGCGTTCTTCATCGATGC\u001b[m\u001b[KCAGAACCAAGAGATCCGTTGTTAAAAGTTTTAATTATTTGCCTGTGCCACTCAGAAGAGACGTCGTGTAAATAGAGTTTGGTTTCCTCCGGCGGGCGCCCCGTCCCCGTGGTGGGGGCCGGCGCCGGGAGGGGAGGCCCGCGAGAGGCTTCCCCTGCCCGCCGAAGCAACGGTTAGGTACGTTCACAAAGGGTTATAGAGCGGTAACTCAGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGACTTTTACTTCTTCTAAATNACCAAGCGTCTAATCACG\n",
      "CGTGATAAGACG\u001b[01;31m\u001b[KGCTGCGTTCTTCATCGATGC\u001b[m\u001b[KCAGAACCAAGAGATCCGTTGTTAAAAGTTTTGATTATTTGCTTGTGCCACTCAGAAGAAACGTCGTTAAATCAGAGTTTGGTTATCCTCCGGCGGACGCCCCGCGTGAGCGGGGCCGGGGGCCCGGGGGGCCGACCGCCGAAGCAACATGTAGGTATGTTCACAAAGGGTTATAGAGTGGTAACTCGATAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGACTTTTACTTCCTCTAAATNACCAAGCGTCTTATCACG\n",
      "CGTGATAAGACG\u001b[01;31m\u001b[KGCTGCGTTCTTCATCGATGC\u001b[m\u001b[KCAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATCAACTAAATGATATATCAGGACTTCACAAAATGAATTCTTGAGTTTTGTATACTGGCGGGCACTTAGCCGGGCGTCCTGGCCAGTTAAGGCTGGGGGCGCCGGCCGCCTGGGTCGGAACCAGGTCGACCCGCCAAAGCAACATAGTGAGTACACAAGGGTGAGAAGGTCATTTCGGCGTTGTAGCGCCTACTCTGGAACCTTTCAATAGAAGTTATTACATTTCAGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATNACCAAGCGTCTTATCACG\n",
      "CGTGATAAGACG\u001b[01;31m\u001b[KGCTGCGTTCTTCATCGATGC\u001b[m\u001b[KCGGAGCCAAGAGATCCGTTGTTGAAAGTTTTTTATAATTAAATTCAAGAATTTCTCGTTCTTCCGGGCTTTTCGCCACGCGGAAAAACGTACTCTAATCGGAAAACAAAGCATTTCAAAATTAGGGCCGACGGTGAGCACTCATTCACCAATGAGCTGACCGGCTCCGCCCTGGAGCCGCCCACCGAGGCAACGAGTCAAAAAAAAACCATACATTCACAAGGGGTTTTGGCGATAGAGAGACGAAAAACGCTCACTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGACTTTTACTTCCTCTAAAGNACCAAGCGTCTTATCACG\n",
      "CGTGATAAGACG\u001b[01;31m\u001b[KGCTGCGTTCTTCATCGATGC\u001b[m\u001b[KCAGAACCAAGAGATCCGTTGTTGAAAGGTTTGTTTTTGATTTGTTACAATCAATGGTTTGATTCAGAATTATGTTGTGTTTCACCGTTTAGGTATGAGTTTGGTTATGGGGTTTGGGCCATCGACGGACGCTCTCCCGGGGCGGTCAGGCCCCCGGCGGCGCTCCCGAAGGACGCCGGTCCGCCGAAGCAACATAAATGGTTTATTAGACACAGGGTTGGGAGTTGGGCCCCAAACGGGAACCCAGACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTATTTCCTCTACATNACCAAGCGTCTTATCACG\n"
     ]
    }
   ],
   "source": [
    "## ITS2 was our linker primer:\n",
    "grep GCTGCGTTCTTCATCGATGC leaf_94.fa | wc -l\n",
    "grep GCTGCGTTCTTCATCGATGC <(head -n 20 leaf_94.fa)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "This forward barcode plus primer is 32 bp long:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 17,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "32\n"
     ]
    }
   ],
   "source": [
    "aa=CGTGATAAGACGGCTGCGTTCTTCATCGATGC\n",
    "echo ${#aa}"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "The reverse primer (ITS1f) was much more degraded, not sure why. So unless we put a bunch of wildcards in our search, we don't turn it up as often. But it is still definitely present, and we can look for its reverse compliment in these merged files to confirm how much we need to clip."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 18,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "34561\n",
      "CGTGATAAGACGGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTCTTCATCAAACCGACGCATCAAAACCGCGTTGGAAAGGTCCACCGGGGGCGCGGGTCTCGCGTCCCCCGAGGAAACAAGGGTATTCATACAAAAGGGTGGGAGGTCGGGCCTGGGGCCCTCACTCGGTAATGATCCCTCCGCAGGTTCACCTACGGAGACCTTGTTACGACTT\u001b[01;31m\u001b[KTTACTTCCTCTAAATGACCAAG\u001b[m\u001b[KCGTCTTATCACG\n",
      "CGTGATAAGACGGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATCAATTAAATGATATATCAGGACTTCACAAAATGAATTCTTGAGTTTTGTATACTGGCGGGCACTTAGCCGGGCGTCCTGGCCAGTTAAGGCTGGGGGCGCCGGCCGCCTGGGTCGGAACCAGGTCGACCCGCCAAAGCAACATAGTGAGTAGACTT\u001b[01;31m\u001b[KTTACTTCCTCTAAATGACCAAG\u001b[m\u001b[KCGTCTTATCACG\n",
      "CGTGATAAGTCGGCTGCGTTCTTCATCGATGCTGGAGCCAAGAGATCCGTTGTTAAAAGTTTTGACAGTTCGCTAAGAACACTCAGAAGTATCGTCGGGTTCGAAAACAGAGATTCTGATGAGACCGGCGGGCACCCTCGCGGGCGCCGCCGAAGCAACAGGTATAATAGTTCACAAAGGGTAGAGAGTATAGTACTCATTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGACTT\u001b[01;31m\u001b[KTTACTTCCTCTAAATGACCAAG\u001b[m\u001b[KCGACTTATCACG\n",
      "CGTGATAAGACGGCTGCGTTCTTCATCGATGCTAGAGCCAAGAGATCCGTTGTTGAAAGTTTTAACAGTTCGCTTTGGAACACTCAGAGGTAACTCATAGAGAAACAGGAGATTCTGAACACCGGCGGGCACGCCCGGAGGCGCGCCGCCGAAGCAACAGGTTTATAAAGTTCACAAAGGGTTATAGAGCGTAAACTCAGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGACTT\u001b[01;31m\u001b[KTTACTTCCTCTAAATGACCAAG\u001b[m\u001b[KCGTCTTATCACG\n",
      "CGTGATAAGACGGCTGCGTTCTTCATCGATGCTGGAGCCAAGAGATCCGTTGTTAAAAGTTTTGACAGTTCGCTAAGAACACTCAGAAGTATCGTCGGGTTCGAAAACAGAGATTCTGATGAGACCGGCGGGCACCCTCGCGGGCGCCGCCGAAGCAACAGGTATAATAGTTCACAAAGGGTAGAGAGTATAGTACTCAGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGACTT\u001b[01;31m\u001b[KTTACTTCCTCTAAATGACCAAG\u001b[m\u001b[KCGTCTTATCACG\n",
      "CGTGATAAGACGGCTGCGTTCTTCATCGATGCTGGAGCCAAGAGATCCGTTGTTAAAAGTTTTGACAGTTCGCTAAGAACACTCAGAAGTATCGTCGGGTTCGAAAACAGAGATTCTGATGAGACCGGCGGGCACCCTCGCGGGCGCCGCCGAAGCAACAGGTATAATAGTTCACAAAGGGTAGAGAGTATAGTACTCAGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGACTT\u001b[01;31m\u001b[KTTACTTCCTCTAAATGACCAAG\u001b[m\u001b[KCGTCTTATCACG\n",
      "CGTGATAAGACGGCTGCGTTCTTCATCGATGCTGGAGCCAAGAGATCCGTTGTTAAAAGTTTTGACAGTTCGCTAAGAACACTCAGAAGTATCGTCGGGTTCGAAAACAGAGATTCTGATGAGGCCGGCGGGCACCCTCGCGGGCGCCGCCGAAGCAACAGGTATAATAGTTCACAAAGGGTAGAGAGTATAGTACTCAGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGACTT\u001b[01;31m\u001b[KTTACTTCCTCTAAATGACCAAG\u001b[m\u001b[KCGTCTTATCACG\n"
     ]
    }
   ],
   "source": [
    "grep TTACTTCCTCTAAATGACCAAG leaf_94.fa | wc -l\n",
    "\n",
    "grep TTACTTCCTCTAAATGACCAAG <(head -n 1000 leaf_94.fa)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 19,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "34\n"
     ]
    }
   ],
   "source": [
    "bb=TTACTTCCTCTAAATGACCAAGCGACTTATCACG\n",
    "echo ${#bb}"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "So we need to clip 32 bps off of the 5' end of our reads, and 34 bps off of our 3' end. Makes sense, Barcodes (12 bp) + ITS2 (20 bp) = 32 bp, and (12 bp) + ITS1f (22 bp) = 34 bp ITS1f.\n",
    "\n",
    "We'll use fastx again:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 22,
   "metadata": {},
   "outputs": [],
   "source": [
    "## leaves:\n",
    "cd /home/daniel/Documents/taiwan/taiwan_combined_biom/demult\n",
    "\n",
    "for i in *; do\n",
    "    fastx_trimmer -i $i -f 33 | fastx_trimmer -t 34 -o ../leafNoPrim/${i/leaf/leafNoPrim}\n",
    "done"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id='chimeras'><h3>Checking for chimeras</h3></a>\n",
    "\n",
    "Let's look for and remove chimeric sequences. For the USEARCH pipeline, we'll use the [ITS1 reference files from UNITE](https://unite.ut.ee/repository.php). "
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "## leaf reads:\n",
    "ITS1_ref='/home/daniel/Documents/submissions/taibioinfo/UNITE/uchime_reference_dataset_28.06.2017/ITS1_ITS2_datasets/uchime_reference_dataset_ITS1_28.06.2017.fasta'\n",
    "\n",
    "cd /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/leafNoPrim\n",
    "\n",
    "( for i in *; do\n",
    "echo $i\n",
    "j=\"../leafNotChim/\"${i/NoPrim/NotChim}\n",
    "k=${j/\\.fa/\\.log}\n",
    "echo $j\n",
    "echo $k\n",
    "usearch -uchime_ref $i \\\n",
    "-db $ITS1_ref \\\n",
    "-nonchimeras $j \\\n",
    "-uchimeout $k \\\n",
    "-strand plus \\\n",
    "-notrunclabels \\\n",
    "&>> ../leafNotChim/leafUchime_stdout.txt\n",
    "done &) &"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "With leaf reads, 14372161 out of 14372164 reads were non-chimeric. So a loss of three reads."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "## wood reads\n",
    "\n",
    "ITS1_ref='/home/daniel/Documents/submissions/taibioinfo/UNITE/uchime_reference_dataset_28.06.2017/ITS1_ITS2_datasets/uchime_reference_dataset_ITS1_28.06.2017.fasta'\n",
    "\n",
    "\n",
    "cd /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodFasta\n",
    "\n",
    "(for i in *; do\n",
    "echo $i\n",
    "j=\"../woodNotChim/\"${i/\\.fasta/\\.notChim\\.fasta}\n",
    "k=${j/\\.fasta/\\.log}\n",
    "echo $j\n",
    "echo $k\n",
    "usearch -uchime_ref $i \\\n",
    "-db $ITS1_ref \\\n",
    "-nonchimeras $j \\\n",
    "-uchimeout $k \\\n",
    "-strand plus \\\n",
    "-notrunclabels \\\n",
    "&>> woodUchime_stdout.txt\n",
    "done &) &"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "With wood reads, 3,732,153 out of 3,743,135 reads were non-chimeric, so 10,982 (0.3%) reads were chimeric. "
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id='ITSx'><h3>Finding ITS1 region</h3></a>"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Even though we trimmed the primers, it seems like to maximize the accuracy of the OTU clustering process, we should get rid of regions that are highly conserved among all fungi, i.e. the small subunit and the 5.8s subunit. Bits of both are in our reads, since our forward primer is seated in the ssu and our reverse in the 5.8s. We can estimate their locations with the ITSx tool. This is computationally a very expensive process, so we'll just look at some reads and estimate \n",
    "\n",
    "I guess we could have done this earlier, after demultiplexing, and skipped our primer clipping step..."
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<h4> Leaf ITS1 region </h4>"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "## look at leaf reads:\n",
    "cd /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/leafNotChim\n",
    "\n",
    "## we gotta get rid of the linebreaks, made a script\n",
    "#wget https://raw.githubusercontent.com/danchurch/taiwan_combined_biom/master/scripts/fasta_remove_linebreaks.py\n",
    "\n",
    "for i in *; do\n",
    "echo $i\n",
    "j=checkITS/${i/\\.fa/_noLB\\.fa}\n",
    "#echo checkITS/${i/\\.fa/_noLB\\.fa}\n",
    "fasta_remove_linebreaks.py $i $j\n",
    "head -n 2 $j >> checkITS/allFirstReads.fa\n",
    "done\n",
    "\n",
    "## what's next? check ITS for all of these. ITXs Binaries are in the working directory. \n",
    "\n",
    "../../ITSx_1.0.11/ITSx \\\n",
    "-i checkITS/allFirstReads.fa \\\n",
    "--preserve T \\\n",
    "--allow_single_domain \\\n",
    "-t F \\\n",
    "-o checkITS/allFirstLeafReads\n"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 3,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "HWI-M01380:62:000000000-A65GR:1:1101:18554:1494\t257 bp.\tSSU: 1-46\tITS1: 47-227\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:20607:1531\t215 bp.\tSSU: 1-46\tITS1: 47-185\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:17026:1493\t238 bp.\tSSU: 1-46\tITS1: 47-208\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:13354:1572\t274 bp.\tSSU: 1-46\tITS1: 47-244\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:11460:1564\t218 bp.\tSSU: 1-46\tITS1: 47-188\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:10872:1538\t306 bp.\tSSU: 1-46\tITS1: 47-276\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:11388:1528\t220 bp.\tSSU: 1-46\tITS1: 47-190\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:23311:1591\t223 bp.\tSSU: 1-46\tITS1: 47-193\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:18478:1515\t221 bp.\tSSU: 1-46\tITS1: 47-191\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:22567:1511\t218 bp.\tSSU: 1-46\tITS1: 47-188\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:16188:8102\t218 bp.\tSSU: 1-46\tITS1: 47-188\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:13293:1512\t250 bp.\tSSU: 1-46\tITS1: 47-220\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:17535:13945\t256 bp.\tSSU: 1-46\tITS1: 47-226\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:17795:1476\t233 bp.\tSSU: 1-46\tITS1: 47-203\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:20518:1570\t247 bp.\tSSU: 1-46\tITS1: 47-217\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:19393:1628\t306 bp.\tSSU: 1-46\tITS1: 47-276\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:20265:1545\t272 bp.\tSSU: 1-46\tITS1: 47-242\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:19686:1594\t221 bp.\tSSU: 1-46\tITS1: 47-191\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:12223:1684\t221 bp.\tSSU: 1-46\tITS1: 47-191\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:16859:1526\t280 bp.\tSSU: 1-46\tITS1: 47-251\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:16350:1548\t228 bp.\tSSU: 1-46\tITS1: 47-198\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:19563:1559\t256 bp.\tSSU: 1-46\tITS1: 47-226\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:19659:17858\t247 bp.\tSSU: 1-46\tITS1: 47-217\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:19423:1534\t247 bp.\tSSU: 1-46\tITS1: 47-217\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:15759:1559\t290 bp.\tSSU: 1-46\tITS1: 47-260\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:12668:1580\t299 bp.\tSSU: 1-46\tITS1: 47-269\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:18626:1612\t230 bp.\tSSU: 1-46\tITS1: 47-200\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:14016:1549\t226 bp.\tSSU: 1-46\tITS1: 47-196\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:16242:1596\t316 bp.\tSSU: 1-46\tITS1: 47-286\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:16967:1574\t315 bp.\tSSU: 1-46\tITS1: 47-285\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:17611:1751\t315 bp.\tSSU: 1-46\tITS1: 47-285\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:17376:1572\t262 bp.\tSSU: 1-46\tITS1: 47-232\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:18413:1620\t226 bp.\tSSU: 1-46\tITS1: 47-197\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:12502:1551\t254 bp.\tSSU: 1-46\tITS1: 47-224\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:14136:1588\t247 bp.\tSSU: 1-46\tITS1: 47-217\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:22288:1585\t231 bp.\tSSU: 1-46\tITS1: 47-201\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:24116:2228\t231 bp.\tSSU: 1-46\tITS1: 47-201\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:16820:2172\t218 bp.\tSSU: 1-46\tITS1: 47-188\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:22300:1569\t228 bp.\tSSU: 1-46\tITS1: 47-198\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:14605:1510\t244 bp.\tSSU: 1-46\tITS1: 47-214\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:17233:1508\t235 bp.\tSSU: 1-46\tITS1: 47-205\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:20704:1564\t263 bp.\tSSU: 1-46\tITS1: 47-233\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:22907:1651\t256 bp.\tSSU: 1-46\tITS1: 47-226\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:9343:1635\t220 bp.\tSSU: 1-46\tITS1: 47-190\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:15739:1609\t316 bp.\tSSU: 1-46\tITS1: 47-286\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:13864:1536\t225 bp.\tSSU: 1-46\tITS1: 47-195\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:22925:1496\t222 bp.\tSSU: 1-46\tITS1: 47-192\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:18074:2064\t230 bp.\tSSU: 1-46\tITS1: 47-200\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "HWI-M01380:62:000000000-A65GR:1:1101:10989:1632\t256 bp.\tSSU: 1-46\tITS1: 47-226\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:14272:1645\t229 bp.\tSSU: 1-46\tITS1: 47-199\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:17796:1515\t267 bp.\tSSU: 1-46\tITS1: 47-237\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:14431:1642\t217 bp.\tSSU: 1-46\tITS1: 47-187\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:18084:1490\t268 bp.\tSSU: 1-46\tITS1: 47-238\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:21934:1698\t218 bp.\tSSU: 1-46\tITS1: 47-188\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:17929:1542\t256 bp.\tSSU: 1-46\tITS1: 47-226\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:13059:1808\t225 bp.\tSSU: 1-46\tITS1: 47-195\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:17820:1593\t227 bp.\tSSU: 1-46\tITS1: 47-197\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:14015:1614\t262 bp.\tSSU: 1-46\tITS1: 47-232\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:17162:1570\t284 bp.\tSSU: 1-46\tITS1: 47-254\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:15973:1961\t255 bp.\tSSU: 1-46\tITS1: 47-225\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:8332:2011\t217 bp.\tSSU: 1-46\tITS1: 47-187\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:16044:1524\t265 bp.\tSSU: 1-46\tITS1: 47-235\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:13546:1550\t228 bp.\tSSU: 1-46\tITS1: 47-198\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:11069:1527\t212 bp.\tSSU: 1-46\tITS1: 47-182\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:13378:1606\t218 bp.\tSSU: 1-46\tITS1: 47-188\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:16179:1617\t258 bp.\tSSU: 1-46\tITS1: 47-228\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:8285:1640\t217 bp.\tSSU: 1-46\tITS1: 47-187\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:18532:1761\t247 bp.\tSSU: 1-46\tITS1: 47-217\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:17601:1673\t235 bp.\tSSU: 1-46\tITS1: 47-205\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:22671:1614\t267 bp.\tSSU: 1-46\tITS1: 47-237\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:21740:1632\t224 bp.\tSSU: 1-46\tITS1: 47-194\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:18431:1577\t251 bp.\tSSU: 1-46\tITS1: 47-221\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:22949:1638\t257 bp.\tSSU: 1-46\tITS1: 47-227\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:18299:1544\t262 bp.\tSSU: 1-46\tITS1: 47-232\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:16620:1552\t218 bp.\tSSU: 1-46\tITS1: 47-188\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:17842:1661\t242 bp.\tSSU: 1-46\tITS1: 47-212\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:22355:1781\t281 bp.\tSSU: 1-46\tITS1: 47-251\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:11632:1535\t225 bp.\tSSU: 1-46\tITS1: 47-195\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:12218:1795\t258 bp.\tSSU: 1-46\tITS1: 47-228\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:18473:1666\t222 bp.\tSSU: 1-46\tITS1: 47-192\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:16786:1564\t257 bp.\tSSU: 1-46\tITS1: 47-227\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:16934:1553\t212 bp.\tSSU: 1-46\tITS1: 47-182\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:20253:2005\t202 bp.\tSSU: 1-46\tITS1: 47-172\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:10735:1630\t287 bp.\tSSU: 1-46\tITS1: 47-257\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:21983:1651\t251 bp.\tSSU: 1-46\tITS1: 47-221\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:19042:1569\t222 bp.\tSSU: 1-46\tITS1: 47-192\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:16704:1532\t258 bp.\tSSU: 1-46\tITS1: 47-228\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:17165:1508\t257 bp.\tSSU: 1-46\tITS1: 47-227\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:16652:1526\t217 bp.\tSSU: 1-46\tITS1: 47-187\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:13587:2315\t246 bp.\tSSU: 1-46\tITS1: 47-216\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:18940:1556\t217 bp.\tSSU: 1-46\tITS1: 47-187\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:18431:1497\t265 bp.\tSSU: 1-46\tITS1: 47-235\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:14128:1555\t237 bp.\tSSU: 1-46\tITS1: 47-207\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:22671:1563\t234 bp.\tSSU: 1-46\tITS1: 47-204\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:9015:1576\t259 bp.\tSSU: 1-46\tITS1: 47-229\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:18700:1506\t251 bp.\tSSU: 1-46\tITS1: 47-221\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "HWI-M01380:62:000000000-A65GR:1:1101:11941:1573\t215 bp.\tSSU: 1-46\tITS1: 47-188\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:25693:14022\t252 bp.\tSSU: 1-46\tITS1: 47-222\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:11938:1520\t213 bp.\tSSU: 1-46\tITS1: 47-183\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:17524:1531\t261 bp.\tSSU: 1-46\tITS1: 47-231\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:10720:1599\t315 bp.\tSSU: 1-46\tITS1: 47-286\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:10075:1488\t218 bp.\tSSU: 1-46\tITS1: 47-188\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:17095:1547\t247 bp.\tSSU: 1-46\tITS1: 47-217\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:20530:1502\t228 bp.\tSSU: 1-46\tITS1: 47-198\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:22229:1575\t315 bp.\tSSU: 1-46\tITS1: 47-286\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:19047:1517\t218 bp.\tSSU: 1-46\tITS1: 47-188\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:23008:1657\t261 bp.\tSSU: 1-46\tITS1: 47-232\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:19954:1613\t230 bp.\tSSU: 1-46\tITS1: 47-200\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:19238:1667\t262 bp.\tSSU: 1-46\tITS1: 47-232\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:14191:1548\t224 bp.\tSSU: 1-46\tITS1: 47-194\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:14748:1806\t217 bp.\tSSU: 1-46\tITS1: 47-187\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:23450:1644\t234 bp.\tSSU: 1-46\tITS1: 47-204\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:14179:1642\t221 bp.\tSSU: 1-46\tITS1: 47-192\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:14265:1824\t231 bp.\tSSU: 1-46\tITS1: 47-201\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:14705:1906\t247 bp.\tSSU: 1-46\tITS1: 47-217\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:20931:1506\t235 bp.\tSSU: 1-46\tITS1: 47-205\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1105:17628:4509\t228 bp.\tSSU: 1-46\tITS1: 47-198\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:16777:1513\t269 bp.\tSSU: 1-46\tITS1: 47-239\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:16062:1537\t250 bp.\tSSU: 1-46\tITS1: 47-220\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:17152:1540\t257 bp.\tSSU: 1-46\tITS1: 47-227\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:15964:1520\t247 bp.\tSSU: 1-46\tITS1: 47-217\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:14237:1529\t234 bp.\tSSU: 1-46\tITS1: 47-204\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:17469:1511\t330 bp.\tSSU: 1-46\tITS1: 47-300\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:9293:1562\t247 bp.\tSSU: 1-46\tITS1: 47-217\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:19418:1617\t318 bp.\tSSU: 1-34\tITS1: 35-288\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:9699:1555\t224 bp.\tSSU: 1-46\tITS1: 47-194\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:14521:1960\t251 bp.\tSSU: 1-46\tITS1: 47-221\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:22287:1556\t258 bp.\tSSU: 1-46\tITS1: 47-228\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "HWI-M01380:62:000000000-A65GR:1:1101:15075:1484\t192 bp.\tSSU: 1-46\tITS1: 47-162\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n"
     ]
    }
   ],
   "source": [
    "cat allFirstLeafReads.positions.txt"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<h4>Wood ITS1 region </h4>"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "cd /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodNotChim\n",
    "\n",
    "for i in *; do\n",
    "echo $i\n",
    "j=checkITS/${i/\\.fasta/_noLB\\.fa}\n",
    "#echo $j\n",
    "fasta_remove_linebreaks.py $i $j\n",
    "head -n 2 $j >> checkITS/allFirstWoodReads.fa\n",
    "done\n",
    "\n",
    "../../ITSx_1.0.11/ITSx \\\n",
    "-i checkITS/allFirstWoodReads.fa \\\n",
    "--preserve T \\\n",
    "--allow_single_domain \\\n",
    "-t F \\\n",
    "-o checkITS/allFirstWoodReads"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 5,
   "metadata": {
    "scrolled": true
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "M01498:244:000000000-ANT97:1:1101:16239:1160\t256 bp.\tSSU: 1-46\tITS1: 47-226\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:13588:1168\t220 bp.\tSSU: 1-46\tITS1: 47-190\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:9388:1167\t256 bp.\tSSU: 1-46\tITS1: 47-226\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:11226:1106\t275 bp.\tSSU: 1-46\tITS1: 47-245\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:20154:1278\t224 bp.\tSSU: 1-46\tITS1: 47-194\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:19378:1196\t257 bp.\tSSU: 1-46\tITS1: 47-227\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:17394:1124\t201 bp.\tSSU: 1-46\tITS1: 47-171\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:20146:1147\t295 bp.\tSSU: 1-105\tITS1: 106-265\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:17229:1152\t290 bp.\tSSU: 1-28\tITS1: 29-260\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:20913:1241\t227 bp.\tSSU: 1-46\tITS1: 47-197\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:19695:1171\t206 bp.\tSSU: 1-46\tITS1: 47-176\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:12399:1275\t319 bp.\tSSU: 1-100\tITS1: 101-289\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:12941:1131\t218 bp.\tSSU: 1-46\tITS1: 47-188\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:9985:1146\t236 bp.\tSSU: 1-46\tITS1: 47-206\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:19494:1232\t279 bp.\tSSU: 1-31\tITS1: 32-249\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:8651:1116\t227 bp.\tSSU: 1-46\tITS1: 47-197\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:21893:1197\t330 bp.\tSSU: 1-46\tITS1: 47-300\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:11438:1160\t218 bp.\tSSU: 1-46\tITS1: 47-188\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:11808:1152\t273 bp.\tSSU: 1-46\tITS1: 47-243\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:18916:1152\t229 bp.\tSSU: 1-46\tITS1: 47-199\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:18017:1208\t208 bp.\tSSU: 1-46\tITS1: 47-178\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:14601:1142\t243 bp.\tSSU: 1-46\tITS1: 47-213\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:10373:1124\t213 bp.\tSSU: 1-46\tITS1: 47-183\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:17038:1125\t169 bp.\tSSU: 1-46\tITS1: 47-139\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:9685:1106\t324 bp.\tSSU: 1-46\tITS1: 47-294\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:17710:1196\t246 bp.\tSSU: 1-46\tITS1: 47-216\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:21981:1137\t218 bp.\tSSU: 1-46\tITS1: 47-188\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:17311:1165\t245 bp.\tSSU: 1-46\tITS1: 47-215\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:8864:1166\t207 bp.\tSSU: 1-46\tITS1: 47-177\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:11943:1111\t240 bp.\tSSU: 1-46\tITS1: 47-210\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:16219:1257\t255 bp.\tSSU: 1-46\tITS1: 47-225\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:19158:1123\t283 bp.\tSSU: 1-46\tITS1: 47-253\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:15016:1162\t304 bp.\tSSU: 1-36\tITS1: 37-274\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:17495:1128\t253 bp.\tSSU: 1-31\tITS1: 32-223\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:9741:1172\t441 bp.\tSSU: 1-46\tITS1: 47-411\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:14225:1134\t225 bp.\tSSU: 1-46\tITS1: 47-195\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:21939:1150\t227 bp.\tSSU: 1-46\tITS1: 47-197\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:19360:1149\t223 bp.\tSSU: 1-46\tITS1: 47-193\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:16600:1148\t218 bp.\tSSU: 1-46\tITS1: 47-188\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:19240:1153\t253 bp.\tSSU: 1-46\tITS1: 47-223\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:9799:1131\t220 bp.\tSSU: 1-46\tITS1: 47-190\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:21590:1296\t247 bp.\tSSU: 1-46\tITS1: 47-217\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:22600:1151\t246 bp.\tSSU: 1-46\tITS1: 47-216\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:11091:1113\t225 bp.\tSSU: 1-46\tITS1: 47-195\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:9736:1131\t215 bp.\tSSU: 1-46\tITS1: 47-185\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:8683:1098\t220 bp.\tSSU: 1-46\tITS1: 47-190\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:16827:1122\t226 bp.\tSSU: 1-46\tITS1: 47-196\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:10261:1107\t263 bp.\tSSU: 1-46\tITS1: 47-233\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:11852:1130\t240 bp.\tSSU: 1-46\tITS1: 47-210\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n"
     ]
    },
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "M01498:244:000000000-ANT97:1:1101:17861:1169\t277 bp.\tSSU: 1-46\tITS1: 47-247\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:13783:1129\t216 bp.\tSSU: 1-46\tITS1: 47-186\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:14904:1772\t253 bp.\tSSU: 1-46\tITS1: 47-223\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:14432:1196\t247 bp.\tSSU: 1-46\tITS1: 47-217\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:10402:1209\t222 bp.\tSSU: 1-46\tITS1: 47-192\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:14952:1145\t306 bp.\tSSU: 1-97\tITS1: 98-276\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:21473:1190\t306 bp.\tSSU: 1-98\tITS1: 99-276\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:13773:1150\t264 bp.\tSSU: 1-46\tITS1: 47-234\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:14728:1130\t226 bp.\tSSU: 1-46\tITS1: 47-196\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:18629:1128\t230 bp.\tSSU: 1-46\tITS1: 47-200\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:16855:1184\t240 bp.\tSSU: 1-46\tITS1: 47-210\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:13615:1126\t268 bp.\tSSU: 1-46\tITS1: 47-238\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:11686:1135\t224 bp.\tSSU: 1-46\tITS1: 47-194\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:20740:1158\t235 bp.\tSSU: 1-46\tITS1: 47-205\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:17497:1153\t193 bp.\tSSU: 1-46\tITS1: 47-163\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:11024:1112\t308 bp.\tSSU: 1-30\tITS1: 31-278\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:9648:1115\t245 bp.\tSSU: 1-46\tITS1: 47-215\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:19826:1289\t252 bp.\tSSU: 1-46\tITS1: 47-222\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:20119:1150\t432 bp.\tSSU: 1-46\tITS1: 47-402\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:11565:1139\t263 bp.\tSSU: 1-46\tITS1: 47-233\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:10605:1108\t296 bp.\tSSU: 1-29\tITS1: 30-266\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:8904:1130\t253 bp.\tSSU: 1-46\tITS1: 47-223\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:14618:1176\t215 bp.\tSSU: 1-46\tITS1: 47-185\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:19794:1335\t226 bp.\tSSU: 1-46\tITS1: 47-196\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:16580:1127\t321 bp.\tSSU: 1-46\tITS1: 47-291\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:10960:1249\t255 bp.\tSSU: 1-46\tITS1: 47-225\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:12834:1500\t240 bp.\tSSU: 1-46\tITS1: 47-210\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:12138:1176\t224 bp.\tSSU: 1-45\tITS1: 46-194\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:13688:1419\t267 bp.\tSSU: 1-46\tITS1: 47-237\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:17424:1167\t243 bp.\tSSU: 1-46\tITS1: 47-213\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:11961:1132\t246 bp.\tSSU: 1-46\tITS1: 47-216\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:11591:1225\t297 bp.\tSSU: 1-98\tITS1: 99-267\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:18492:1265\t227 bp.\tSSU: 1-46\tITS1: 47-197\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:15095:1316\t367 bp.\tSSU: 1-46\tITS1: 47-337\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:21265:1139\t339 bp.\tSSU: 1-46\tITS1: 47-309\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:9206:1132\t225 bp.\tSSU: 1-46\tITS1: 47-195\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:17063:1138\t237 bp.\tSSU: 1-46\tITS1: 47-207\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:22743:1348\t226 bp.\tSSU: 1-46\tITS1: 47-196\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:13103:1163\t296 bp.\tSSU: 1-29\tITS1: 30-266\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:22846:1154\t224 bp.\tSSU: 1-46\tITS1: 47-194\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:10128:1110\t228 bp.\tSSU: 1-46\tITS1: 47-198\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:10001:1231\t268 bp.\tSSU: 1-46\tITS1: 47-238\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:14286:1119\t291 bp.\tSSU: 1-46\tITS1: 47-261\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:9437:1245\t220 bp.\tSSU: 1-46\tITS1: 47-190\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:12858:1202\t225 bp.\tSSU: 1-46\tITS1: 47-195\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:10277:1206\t222 bp.\tSSU: 1-46\tITS1: 47-192\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:7376:2233\t222 bp.\tSSU: 1-46\tITS1: 47-192\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:20670:1138\t250 bp.\tSSU: 1-46\tITS1: 47-220\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n",
      "M01498:244:000000000-ANT97:1:1101:18762:1148\t244 bp.\tSSU: 1-46\tITS1: 47-214\t5.8S: No end\tITS2: Not found\tLSU: Not found\tBroken or partial sequence, only partial 5.8S! \n"
     ]
    }
   ],
   "source": [
    "cat allFirstWoodReads.positions.txt"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "So in both the leaves and the wood, we see that the large subunit usually ends at bp 46 of the read, and the small subunit begins at 30 bp before the end of the read. There are some exceptions, but the ITSx algorithms are computationally expensive, if we run them on our entire data set it can take days to weeks. So we'll do our best here to reduce the role of more highly conserved regions of the read (the 18s and 28s) in our OTU clustering, which is intended to capture species-ish diversity. \n",
    "\n",
    "We do this by clipping 46 bp off of the 5' end of our reads, and 30 bp off of the 3':"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "## woods\n",
    "cd /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodNotChim\n",
    "\n",
    "for i in *fasta; do\n",
    "#echo $i\n",
    "echo ${i/notChim/ITSonly}\n",
    "fastx_trimmer -i <(fasta_formatter -i $i)  -f 47 | fastx_trimmer -t 30 -o ../woodITSonly/${i/notChim/ITSonly}\n",
    "done\n",
    "\n",
    "## and leaves:\n",
    "cd /home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/leafNotChim\n",
    "\n",
    "for i in *fa; do\n",
    "echo $i\n",
    "#echo ../leafITSonly/${i/notChim/ITSonly}\n",
    "fastx_trimmer -i <(fasta_formatter -i $i)  -f 47 | fastx_trimmer -t 30 -o ../leafITSonly/${i/notChim/ITSonly}\n",
    "done\n",
    "\n",
    "## combine these into a single, big file of both leaves and reads:\n",
    "\n",
    "leafITSonly=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trim_leaves/leafITSonly\n",
    "woodITSonly=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/trimmed_wood/woodITSonly\n",
    "\n",
    "cat $leafITSonly/* $woodITSonly/* > allReads.fasta"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<h3><a id='OTUclust'>OTU clustering</a></h3>\n",
    "\n",
    "With labels simplified and reads reduced to ITS1 region. This is three steps, actually: dereplication, sorting, and clustering. "
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id='derep'><h4>Dereplication and Sorting of reads</h4></a>\n",
    "\n",
    "We've been doing this pipeline with USEARCH, 32-bit. Not sure how this works, but this free version of USEARCH restricts RAM usage to 4 gig. If loading databases of reads takes more than this, we're punted, with a message that basically says \"buy the 64 bit version, you bum.\"\n",
    "\n",
    "So I went to Oslo and got a copy of [VSEARCH](#https://github.com/torognes/vsearch). This is an open-source, freely available parallel to USEARCH. Since I am trying to rebuild a pipeline previously with USEARCH 64-bit (not available to me now), we'll use VSEARCH sparingly, when memory limits are a problem. "
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "## get rid of singletons for clustering while we're at it\n",
    "vsearch --derep_fulllength allReads.fasta \\\n",
    "--output allReads_derep.fasta \\\n",
    "--sizeout \\\n",
    "--minseqlength 1 \\\n",
    "--minuniquesize 2 \\\n",
    "&> derep_stdout.log"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 7,
   "metadata": {
    "scrolled": true
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "vsearch v2.8.0_linux_x86_64, 11.5GB RAM, 4 cores\n",
      "https://github.com/torognes/vsearch\n",
      "\n",
      "Reading file allReads.fasta 100%\n",
      "3203788852 nt in 18101955 seqs, min 2, max 373, avg 177\n",
      "Dereplicating 100%\n",
      "Sorting 100%\n",
      "2961231 unique sequences, avg cluster 6.1, median 1, max 472437\n",
      "Writing output file 100%\n",
      "748827 uniques written, 2212404 clusters discarded (74.7%)\n"
     ]
    }
   ],
   "source": [
    "cat derep_stdout.log"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "To sort, we go back to USEARCH..."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "usearch -sortbysize allReads_derep.fasta -fastaout allReads_sorted.fasta &> usearch_sort_stdout.log"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 9,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:02 224Mb  100.0% Reading allReads_derep.fasta\n",
      "00:02 191Mb Getting sizes                       \n",
      "00:03 197Mb Sorting 748827 sequences\n",
      "00:06 200Mb  100.0% Writing output\n"
     ]
    }
   ],
   "source": [
    "cat usearch_sort_stdout.log"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id='Cluster'><h4>Cluster reads</h4></a>"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "usearch -cluster_smallmem allReads_sorted.fasta \\\n",
    "-id 0.95 \\\n",
    "-centroids otus_95_combo.fasta \\\n",
    "-sizein \\\n",
    "-sizeout \\\n",
    "-sortedby size \\\n",
    "|& tee clust_stdout.log"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 11,
   "metadata": {
    "scrolled": false
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:48  59Mb  100.0% 12601 clusters, max size 681167, avg 1261.0\n",
      "00:48  59Mb  100.0% Writing centroids to otus_95_combo.fasta   \n",
      "                                                            \n",
      "      Seqs  748827 (748827 ()\n",
      "  Clusters  12601 (12601 (12601 (126)\n",
      "  Max size  681167 (681167 (681167 (681167 (6)\n",
      "  Avg size  1261.0\n",
      "  Min size  2\n",
      "Singletons  0, 0.0% of seqs, 0.0% of clusters\n",
      "   Max mem  59Mb\n",
      "      Time  48.0s\n",
      "Throughput  15.6k seqs/sec.\n",
      "\n"
     ]
    }
   ],
   "source": [
    "cat clust_stdout.log"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "12,601 clusters (otus). ~2000 more than our last pipeline. Not sure why, though I did several things differently, including NOT seeding this pipeline with Roo's hand curated *Xylaria* stromata. We also had many more unique sequences going into this step this time around, ~750,000 seqs, compared to ~450,000 last time I did this, with the same data. Hmmm...."
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id='addOTUtag'><h4>Assign unique names to OTU clusters</h4></a>\n",
    "\n",
    "In this older version of USEARCH, with the `-cluster_smallmem` command, there was no option to give unique identifiers to the OTU clusters. So I made a script, which gives a label of your choice (here \"OTU\") plus a number, from the order in which the clusters were created. "
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "./addOTUtag.py otus_95_combo.fasta OTU otus_95_combo_relab.fasta"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id=assTax><h4>Assign taxonomy</h4></a>\n",
    "\n",
    "We'll do a mass, low-confidence assignment of taxonomy to our OTU clusters using UTAX and UNITE. These aren't to be used for any real analysis, just a quick first glance. If we become interested in an OTU, we'll need to take some time to look for a higher confidence taxonomic assignment. "
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "## get the suggested version of UNITE. \n",
    "wget https://drive5.com/utax/data/utax_unite_v7.tar.gz\n",
    "tar -xzvf utax_unite_v7.tar.gz\n",
    "\n",
    "## some useful shortcuts:\n",
    "ITS1db=/home/daniel/Documents/submissions/taibioinfo/UNITE/utaxref/unite_v7/fasta/refdb.fa\n",
    "ITS1tf=/home/daniel/Documents/submissions/taibioinfo/UNITE/utaxref/unite_v7/taxconfs/its1.tc\n",
    "OTUs=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/OTUclust/otus_95_combo_relab.fasta\n",
    "\n",
    "## make a USEARCH database out of UNITE\n",
    "usearch -makeudb_utax $ITS1db  -taxconfsin $ITS1tf -output ITS1tax.udb |& tee assTax.log\n",
    "\n",
    "## use this and the \n",
    "search -utax $OTUs -db ITS1tax.udb -fastaout OTUs_95_assTaxed.fasta -strand plus |& OtuAssTaxed.log"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<a id='makeBiom'><h3>Make biom table</h3></a>\n",
    "\n",
    "We can now assemble the biom table. We'll make the first generation format of biom tables, which was a json format. I prefer this to the later compiled file, hdf5-format, because it's human readable. Taxonomy assignments get thrown in for free during this step of biom table construction via uparse. \n",
    "\n",
    "To parse correctly, we need to get rid of \"-\" dashes in our sample names, it doesn't parse with USEARCH. So... more sed..."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "allReads=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/OTUclust/allReads.fasta\n",
    "\n",
    "sed -E '/>Dc-X/ s/(Dc)-(X)/\\1_\\2/g' $allReads |\\\n",
    "sed -E '/>Dc-PosG/ s/(Dc)-(PosG)/\\1_\\2/' |\\\n",
    "sed -E '/>Dc-PosI/ s/(Dc)-(PosI)/\\1_\\2/' |\\\n",
    "sed -E '/>Dc-Neg/ s/(Dc)-(Neg)/\\1_\\2/' > allReads_con.fasta"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "While we're at it, let's get rid of our unmatched reads:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "sed -i '/>leafNotChim_unmatched/,+1d' $allReadsCon"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Make the table:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 33,
   "metadata": {
    "scrolled": true
   },
   "outputs": [],
   "source": [
    "allReadsCon=/home/daniel/Documents/submissions/taibioinfo/taiwan_combined_biom/assTax/allReads_con.fasta\n",
    "\n",
    "usearch -usearch_global $allReadsCon -db OTUs_95_assTaxed.fasta -strand plus -id 0.95 -biomout combo_otu.biom |& tee makebiom.log"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 34,
   "metadata": {
    "scrolled": true
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "usearch v8.1.1861_i86linux32, 4.0Gb RAM (12.1Gb total), 4 cores\n",
      "(C) Copyright 2013-15 Robert C. Edgar, all rights reserved.\n",
      "http://drive5.com/usearch\n",
      "\n",
      "License: danchurchthomas@gmail.com\n",
      "\n",
      "00:00  44Mb  100.0% Reading ./assTax/OTUs_95_assTaxed.fasta\n",
      "00:00  10Mb  100.0% Masking                                \n",
      "00:00  11Mb  100.0% Word stats\n",
      "00:00  11Mb  100.0% Alloc rows\n",
      "00:00  19Mb  100.0% Build index\n",
      "07:25  90Mb  100.0% Searching allReads_con.fasta, 100.4% matched\n",
      "15442054 / 15456309 mapped to OTUs (99.9%)                      \n",
      "07:25  90Mb Writing combo_otu.biom\n",
      "07:25  90Mb Writing combo_otu.biom ...done.\n"
     ]
    }
   ],
   "source": [
    "cat makebiom.log"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Well, that's nice. But now we have to do a lot of cleaning up, and add metadata."
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<h2><a id='formBiom'>Formatting Biom table and adding metadata</a></h2>"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<h3><a id='formTax'>Change biom taxonomy metadata format</a></h3>\n",
    "\n",
    "Let's change the standard USEARCH taxonomy formatting to Greengenes database formatting. Our usearch output looks like this:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 35,
   "metadata": {
    "scrolled": true
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "\t\"\u001b[01;31m\u001b[Krows\u001b[m\u001b[K\":[\n",
      "\t\t{\"id\":\"OTU19:leafNotChim_100\", \"metadata\":{\"taxonomy\":\"d:Fungi,p:Ascomycota(0.3128),c:Eurotiomycetes(0.2065),o:Onygenales(0.1099),f:Arthrodermataceae(0.0449),g:Arthroderma(0.0202),s:Arthroderma_melis_SH007610.07FU(0.0022)\"}},\n",
      "\t\t{\"id\":\"OTU108:leafNotChim_100\", \"metadata\":{\"taxonomy\":\"d:Fungi,p:Ascomycota(0.1084),c:Eurotiomycetes(0.0620),o:Pyrenulales(0.0299),f:Massariaceae(0.0138),g:Massaria(0.0060)\"}},\n",
      "\t\t{\"id\":\"OTU1:leafNotChim_100\", \"metadata\":{\"taxonomy\":\"d:Fungi,p:Ascomycota(0.9897),c:Sordariomycetes(0.7674),o:Hypocreales(0.5816),f:Hypocreales_fam_Incertae_sedis(0.3979),g:Myrothecium(0.2279)\"}},\n",
      "\t\t{\"id\":\"OTU202:leafNotChim_100\", \"metadata\":{\"taxonomy\":\"d:Fungi,p:Ascomycota(0.4325),c:Dothideomycetes(0.2853),o:Dothideomycetidae_ord_Incertae_sedis(0.1601),f:Strigulaceae(0.0654),g:Strigula(0.0309),s:Strigula_smaragdula_SH211054.07FU(0.0045)\"}},\n",
      "\t\t{\"id\":\"OTU426:leafNotChim_100\", \"metadata\":{\"taxonomy\":\"d:Fungi,p:Ascomycota(0.2072),c:Dothideomycetes(0.1317)\"}},\n"
     ]
    }
   ],
   "source": [
    "grep rows combo_otu.biom -A 5"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Let's edit this with SED:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 38,
   "metadata": {},
   "outputs": [],
   "source": [
    "sed '/taxonomy/ s/([0-1]\\.[0-9]*)//g' combo_otu.biom |\\\n",
    "sed -E 's/(\"taxonomy\")(:\")/\\1:[/' |\\\n",
    "sed -E 's/\"}}/,]}}/' |\\\n",
    "sed -E '/taxonomy/ s/(d:)([^,]*)/\"k__\\2\"/' |\\\n",
    "sed -E '/taxonomy/ s/(p:)([^,]*)/\"p__\\2\"/' |\\\n",
    "sed -E '/taxonomy/ s/(c:)([^,]*)/\"c__\\2\"/' |\\\n",
    "sed -E '/taxonomy/ s/(o:)([^,]*)/\"o__\\2\"/' |\\\n",
    "sed -E '/taxonomy/ s/(f:)([^,]*)/\"f__\\2\"/' |\\\n",
    "sed -E '/taxonomy/ s/(g:)([^,]*)/\"g__\\2\"/' |\\\n",
    "sed -E '/taxonomy/ s/(s:)([^,]*)/\"s__\\2\"/' |\\\n",
    "sed -E '/taxonomy/ s/,]}}/]}}/' > combo_otu_relab.biom"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 39,
   "metadata": {
    "scrolled": true
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "\t\"\u001b[01;31m\u001b[Krows\u001b[m\u001b[K\":[\n",
      "\t\t{\"id\":\"OTU19:leafNotChim_100\", \"metadata\":{\"taxonomy\":[\"k__Fungi\",\"p__Ascomycota\",\"c__Eurotiomycetes\",\"o__Onygenales\",\"f__Arthrodermataceae\",\"g__Arthroderma\",\"s__Arthroderma_melis_SH007610.07FU\"]}},\n",
      "\t\t{\"id\":\"OTU108:leafNotChim_100\", \"metadata\":{\"taxonomy\":[\"k__Fungi\",\"p__Ascomycota\",\"c__Eurotiomycetes\",\"o__Pyrenulales\",\"f__Massariaceae\",\"g__Massaria\"]}},\n",
      "\t\t{\"id\":\"OTU1:leafNotChim_100\", \"metadata\":{\"taxonomy\":[\"k__Fungi\",\"p__Ascomycota\",\"c__Sordariomycetes\",\"o__Hypocreales\",\"f__Hypocreales_fam_Incertae_sedis\",\"g__Myrothecium\"]}},\n",
      "\t\t{\"id\":\"OTU202:leafNotChim_100\", \"metadata\":{\"taxonomy\":[\"k__Fungi\",\"p__Ascomycota\",\"c__Dothideomycetes\",\"o__Dothideomycetidae_ord_Incertae_sedis\",\"f__Strigulaceae\",\"g__Strigula\",\"s__Strigula_smaragdula_SH211054.07FU\"]}},\n",
      "\t\t{\"id\":\"OTU426:leafNotChim_100\", \"metadata\":{\"taxonomy\":[\"k__Fungi\",\"p__Ascomycota\",\"c__Dothideomycetes\"]}},\n"
     ]
    }
   ],
   "source": [
    "grep rows combo_otu_relab.biom -A 5"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Looks good. But the leafNotChim thing is annoying, especially with our sample ids. So change this:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 40,
   "metadata": {},
   "outputs": [],
   "source": [
    "sed -E -i 's/(leaf)(NotChim_)([0-9]*)/\\3\\1/g' combo_otu_relab.biom"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 41,
   "metadata": {
    "scrolled": false
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "\t\"\u001b[01;31m\u001b[Krows\u001b[m\u001b[K\":[\n",
      "\t\t{\"id\":\"OTU19:100leaf\", \"metadata\":{\"taxonomy\":[\"k__Fungi\",\"p__Ascomycota\",\"c__Eurotiomycetes\",\"o__Onygenales\",\"f__Arthrodermataceae\",\"g__Arthroderma\",\"s__Arthroderma_melis_SH007610.07FU\"]}},\n",
      "\t\t{\"id\":\"OTU108:100leaf\", \"metadata\":{\"taxonomy\":[\"k__Fungi\",\"p__Ascomycota\",\"c__Eurotiomycetes\",\"o__Pyrenulales\",\"f__Massariaceae\",\"g__Massaria\"]}},\n",
      "\t\t{\"id\":\"OTU1:100leaf\", \"metadata\":{\"taxonomy\":[\"k__Fungi\",\"p__Ascomycota\",\"c__Sordariomycetes\",\"o__Hypocreales\",\"f__Hypocreales_fam_Incertae_sedis\",\"g__Myrothecium\"]}},\n",
      "\t\t{\"id\":\"OTU202:100leaf\", \"metadata\":{\"taxonomy\":[\"k__Fungi\",\"p__Ascomycota\",\"c__Dothideomycetes\",\"o__Dothideomycetidae_ord_Incertae_sedis\",\"f__Strigulaceae\",\"g__Strigula\",\"s__Strigula_smaragdula_SH211054.07FU\"]}},\n",
      "\t\t{\"id\":\"OTU426:100leaf\", \"metadata\":{\"taxonomy\":[\"k__Fungi\",\"p__Ascomycota\",\"c__Dothideomycetes\"]}},\n",
      "\t\t{\"id\":\"OTU1905:100leaf\", \"metadata\":{\"taxonomy\":[\"k__Fungi\",\"p__Ascomycota\"]}},\n",
      "\t\t{\"id\":\"OTU10:100leaf\", \"metadata\":{\"taxonomy\":[\"k__Fungi\",\"p__Ascomycota\",\"c__Lecanoromycetes\"]}},\n",
      "\t\t{\"id\":\"OTU10433:17leaf\", \"metadata\":{\"taxonomy\":[\"k__Fungi\",\"p__Ascomycota\",\"c__Sordariomycetes\",\"o__Hypocreales\",\"f__Hypocreales_fam_Incertae_sedis\",\"g__Myrothecium\"]}},\n",
      "\t\t{\"id\":\"OTU17:100leaf\", \"metadata\":{\"taxonomy\":[\"k__Fungi\",\"p__Ascomycota\",\"c__Dothideomycetes\",\"o__Pleosporales\"]}},\n",
      "\t\t{\"id\":\"OTU429:100leaf\", \"metadata\":{\"taxonomy\":[\"k__Fungi\",\"p__Ascomycota\",\"c__Sordariomycetes\",\"o__Hypocreales\",\"f__Hypocreales_fam_Incertae_sedis\",\"g__Myrothecium\"]}},\n"
     ]
    }
   ],
   "source": [
    "grep rows -A 10 combo_otu_relab.biom"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 42,
   "metadata": {
    "scrolled": false
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "\t\"\u001b[01;31m\u001b[Kcolumns\u001b[m\u001b[K\":[\n",
      "\t\t{\"id\":\"100leaf\", \"metadata\":null},\n",
      "\t\t{\"id\":\"101leaf\", \"metadata\":null},\n",
      "\t\t{\"id\":\"102leaf\", \"metadata\":null},\n",
      "\t\t{\"id\":\"103leaf\", \"metadata\":null},\n",
      "\t\t{\"id\":\"104leaf\", \"metadata\":null},\n",
      "\t\t{\"id\":\"105leaf\", \"metadata\":null},\n",
      "\t\t{\"id\":\"106leaf\", \"metadata\":null},\n",
      "\t\t{\"id\":\"107leaf\", \"metadata\":null},\n",
      "\t\t{\"id\":\"108leaf\", \"metadata\":null},\n",
      "\t\t{\"id\":\"109leaf\", \"metadata\":null},\n"
     ]
    }
   ],
   "source": [
    "grep columns -A 10 combo_otu_relab.biom"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Looks okay. Check to see if the biom package can find problems:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 43,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Invalid format 'Biological Observation Matrix 1.0', must be '1.0.0'\n",
      "'id' in {'metadata': {'taxonomy': ['k__Fungi', 'p__Ascomycota', 'c__Sordariomycetes', 'o__Ophiostomatales', 'f__Ophiostomataceae', 'g__Pesotum']}, 'id': ''} appears empty\n",
      "Bad value at idx 0: [0, 0, 81511]\n",
      "Timestamp does not appear to be ISO 8601\n",
      "The input file is not a valid BIOM-formatted file.\n"
     ]
    },
    {
     "ename": "",
     "evalue": "1",
     "output_type": "error",
     "traceback": []
    }
   ],
   "source": [
    "biom validate-table -i combo_otu_relab.biom"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Don't know why this name was left off, but this happened before. Find the OTU and fill in the name manually:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 44,
   "metadata": {
    "scrolled": false
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "\t\t{\"id\":\"OTU10613:leafNotChim_111\", \"metadata\":{\"taxonomy\":\"d:Fungi\"}},\n",
      "\t\t{\"id\":\"\", \"metadata\":{\"taxonomy\":\"d:Fungi,p:Ascomycota(0.3128),c:Sordariomycetes(0.2065),o:Ophiostomatales(0.1099),f:Ophiostomataceae(0.0449),\u001b[01;31m\u001b[Kg:Pesotum\u001b[m\u001b[K(0.0202)\"}},\n",
      "\t\t{\"id\":\"OTU7760:leafNotChim_111\", \"metadata\":{\"taxonomy\":\"d:Fungi,p:Ascomycota(0.2072),c:Schizosaccharomycetes(0.1317),o:Schizosaccharomycetales(0.0620),f:Schizosaccharomycetaceae(0.0273),g:Schizosaccharomyces(0.0108)\"}},\n"
     ]
    }
   ],
   "source": [
    "grep \"g:Pesotum\" combo_otu.biom -A 1 -B 1"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Let's find this in our OTU clusters that have had taxonomy assignments:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 45,
   "metadata": {
    "scrolled": true
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      ">OTU6797:leafNotChim_111;size=16;tax=d:Fungi,p:Ascomycota(0.3128),c:Sordariomycetes(0.2065),o:Ophiostomatales(0.1099),f:Ophiostomataceae(0.0449),\u001b[01;31m\u001b[Kg:Pesotum(0.0202)\u001b[m\u001b[K;\n"
     ]
    }
   ],
   "source": [
    "grep \"g:Pesotum(0.0202)\" OTUs_95_assTaxed.fasta"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Fill this into our OTU table with sed:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 46,
   "metadata": {},
   "outputs": [],
   "source": [
    "sed '/\"id\":\"\"/ s/\"id\":\"\",/\"id\":\"OTU6797:111leaf\",/' combo_otu_relab.biom -i"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 47,
   "metadata": {
    "scrolled": true
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Invalid format 'Biological Observation Matrix 1.0', must be '1.0.0'\n",
      "Bad value at idx 0: [0, 0, 81511]\n",
      "Timestamp does not appear to be ISO 8601\n",
      "The input file is not a valid BIOM-formatted file.\n"
     ]
    },
    {
     "ename": "",
     "evalue": "1",
     "output_type": "error",
     "traceback": []
    }
   ],
   "source": [
    "biom validate-table -i combo_otu_relab.biom"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Beh. Minor stuff. Onward..."
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<h3><a id='addMetadata'>Add sample metadata</a></h3>\n",
    "\n",
    "We have a spreadsheet with our sample metadata on it. We can use this to assign useful info about each of our samples, with the `biom add-metadata` command:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 17,
   "metadata": {
    "scrolled": false
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "#SampleID\tLibrary\tSorC\tX\tY\tForest_Type\tHost_family\tHost_genus\tHost_species\tHost_genus_species\tstream_distance\tvegcom\n",
      "Dc_X\tW\tControl\tNA\tNA\tNA\tNA\tNA\tNA\tNA\tNA\tNA\n",
      "Dc_PosG\tW\tControl\tNA\tNA\tNA\tNA\tNA\tNA\tNA\tNA\tNA\n",
      "Dc_PosI\tW\tControl\tNA\tNA\tNA\tNA\tNA\tNA\tNA\tNA\tNA\n",
      "Dc_Neg\tW\tControl\tNA\tNA\tNA\tNA\tNA\tNA\tNA\tNA\tNA\n",
      "1w\tW\tSample\t360\t220\t7\tJuglandaceae\tEngelhardtia\troxburghiana\tEngelhardtia_roxburghiana\t24.11897\t2\n",
      "2w\tW\tSample\t360\t221\t7\tTheaceae\tPyrenaria\tshinkoensis\tPyrenaria_shinkoensis\t23.22664\t2\n",
      "3w\tW\tSample\t361\t221\t7\tProteaceae\tHelicia\tformosana\tHelicia_formosana\t22.77525\t2\n",
      "4w\tW\tSample\t361\t220\t7\tTheaceae\tPyrenaria\tshinkoensis\tPyrenaria_shinkoensis\t23.66758\t2\n",
      "5w\tW\tSample\t363\t220\t7\tTheaceae\tPyrenaria\tshinkoensis\tPyrenaria_shinkoensis\t22.7648\t2\n"
     ]
    }
   ],
   "source": [
    "head meta_2018.06.14.tsv"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 1,
   "metadata": {},
   "outputs": [],
   "source": [
    "biom add-metadata -i combo_otu_relab.biom -o combo_otu_wMeta.biom --sample-metadata-fp  meta_2018.06.14.tsv --output-as-json"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 2,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "\n",
      "The input file is a valid BIOM-formatted file.\n"
     ]
    }
   ],
   "source": [
    "## just checking:\n",
    "biom validate-table -i combo_otu_wMeta.biom"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "This command adds metadata to each of our sites, but it mashes our biom file into a single line, making it really hard to read."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 3,
   "metadata": {
    "scrolled": true
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "{\"id\": \"None\",\"format\": \"Biological Observation Matrix 1.0.0\",\"format_url\": \"http://biom-format.org\",\"matrix_type\": \"sparse\",\"generated_by\": \"BIOM-Format 2.1.6\",\"date\": \"2018-06-17T13:56:51.200393\",\"type\": \"OTU table\",\"matrix_element_type\": \"float\",\"shape\": [11588, 232],\"data\": [[0,0,81511.0],[0,1,178.0],[0,3,1145.0],[0,4,3.0],[0,27,1.0],[0,35,226.0],[0,37,939.0],[0,51,1.0],[0,54,2.0],[0,93,2.0],[0,114,57.0],[0,122,1.0],[0,125,43.0],[0,127,13282.0],[0,128,2.0],[0,129,1.0],[1,0,26184.0],[1,3,7.0],[1,4,3504.0],[1,33,1.0],[1,128,2.0],[2,0,2735.0],[2,1,6795.0],[2,2,586.0],[2,3,4290.0],[2,4,2898.0],[2,5,5424.0],[2,6,1.0],[2,7,3.0],[2,8,859.0],[2,9,504.0],[2,10,435.0],[2,11,1191.0],[2,12,2.0],[2,13,259.0],[2,14,9.0],[2,15,7.0],[2,16,530.0],[2,17,25.0],[2,18,6454.0],[2,19,8038.0],[2,20,2138.0],[2,21,6263.0],[2,22,6891.0],[2,23,3186.0],[2,24,1138.0],[2,25,6137.0],[2,26,7641.0],[2,27,1.0],[2,28,65417.0],[2,29,3333.0],[2,30,848.0],[2,31,886.0],[2,32,5517.0],[2,33,6203.0],[2,34,484.0],[2,35,742.071\"}},{\"id\": \"133w\", \"metadata\": {\"vegcom\": \"3\", \"stream_distance\": \"22.16354\", \"Host_genus\": \"Helicia\", \"Host_genus_species\": \"Helicia_formosana\", \"Library\": \"W\", \"Forest_Type\": \"7\", \"Host_species\": \"formosana\", \"X\": \"47\", \"Host_family\": \"Proteaceae\", \"SorC\": \"Sample\", \"Y\": \"47\"}},{\"id\": \"Neg\", \"metadata\": {\"vegcom\": \"NA\", \"stream_distance\": \"NA\", \"Host_genus\": \"NA\", \"Host_genus_species\": \"NA\", \"Library\": \"W\", \"Forest_Type\": \"NA\", \"Host_species\": \"NA\", \"X\": \"NA\", \"Host_family\": \"NA\", \"SorC\": \"Control\", \"Y\": \"NA\"}},{\"id\": \"PosG\", \"metadata\": {\"vegcom\": \"NA\", \"stream_distance\": \"NA\", \"Host_genus\": \"NA\", \"Host_genus_species\": \"NA\", \"Library\": \"W\", \"Forest_Type\": \"NA\", \"Host_species\": \"NA\", \"X\": \"NA\", \"Host_family\": \"NA\", \"SorC\": \"Control\", \"Y\": \"NA\"}},{\"id\": \"PosI\", \"metadata\": {\"vegcom\": \"NA\", \"stream_distance\": \"NA\", \"Host_genus\": \"NA\", \"Host_genus_species\": \"NA\", \"Library\": \"W\", \"Forest_Type\": \"NA\", \"Host_species\": \"NA\", \"X\": \"NA\", \"Host_family\": \"NA\", \"SorC\": \"Control\", \"Y\": \"NA\"}}]}"
     ]
    }
   ],
   "source": [
    "head -c 1000 combo_otu_wMeta.biom; tail -c 1000 combo_otu_wMeta.biom"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Let's use [js-beautify](https://www.npmjs.com/package/js-beautify) to re-render into a multi-line json:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 4,
   "metadata": {},
   "outputs": [],
   "source": [
    "js-beautify combo_otu_wMeta.biom > combo_otu_wMeta_pretty.biom"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 5,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "\n",
      "The input file is a valid BIOM-formatted file.\n"
     ]
    }
   ],
   "source": [
    "biom validate-table -i combo_otu_wMeta_pretty.biom"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 6,
   "metadata": {
    "scrolled": true
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "{\n",
      "    \"id\": \"None\",\n",
      "    \"format\": \"Biological Observation Matrix 1.0.0\",\n",
      "    \"format_url\": \"http://biom-format.org\",\n",
      "    \"matrix_type\": \"sparse\",\n",
      "    \"generated_by\": \"BIOM-Format 2.1.6\",\n",
      "    \"date\": \"2018-06-17T13:56:51.200393\",\n",
      "    \"type\": \"OTU table\",\n",
      "    \"matrix_element_type\": \"float\",\n",
      "    \"shape\": [11588, 232],\n",
      "    \"data\": [\n",
      "        [0, 0, 81511.0],\n",
      "        [0, 1, 178.0],\n",
      "        [0, 3, 1145.0],\n",
      "        [0, 4, 3.0],\n",
      "        [0, 27, 1.0],\n",
      "        [0, 35, 226.0],\n",
      "        [0, 37, 939.0],\n",
      "        [0, 51, 1.0],\n",
      "        [0, 54, 2.0],\n"
     ]
    }
   ],
   "source": [
    "head -n 20 combo_otu_wMeta_pretty.biom"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Our sample metadata is here:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 7,
   "metadata": {
    "scrolled": true
   },
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "    \"\u001b[01;31m\u001b[Kcolumns\u001b[m\u001b[K\": [{\n",
      "        \"id\": \"100leaf\",\n",
      "        \"metadata\": {\n",
      "            \"vegcom\": \"2\",\n",
      "            \"stream_distance\": \"25.97654\",\n",
      "            \"Host_genus\": \"Helicia\",\n",
      "            \"Host_genus_species\": \"Helicia_formosana\",\n",
      "            \"Library\": \"L\",\n",
      "            \"Forest_Type\": \"7\",\n",
      "            \"Host_species\": \"formosana\",\n",
      "            \"X\": \"183\",\n",
      "            \"Host_family\": \"Proteaceae\",\n",
      "            \"SorC\": \"Sample\",\n",
      "            \"Y\": \"20\"\n",
      "        }\n",
      "    }, {\n",
      "        \"id\": \"101leaf\",\n",
      "        \"metadata\": {\n",
      "            \"vegcom\": \"3\",\n",
      "            \"stream_distance\": \"18.36984\",\n",
      "            \"Host_genus\": \"Helicia\",\n"
     ]
    }
   ],
   "source": [
    "grep columns combo_otu_wMeta_pretty.biom -A 20"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "So we should be good - biom table is constructed, clean of major errors, with taxonomic and sample metadata attached. \n",
    "\n",
    "We will do most of our downstream manipulations of this biom table with [phyloseq](https://joey711.github.io/phyloseq/), a package made for handling microbial community data in R. \n",
    "\n",
    "Let's check to see if phyloseq likes our biom table:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 1,
   "metadata": {},
   "outputs": [],
   "source": [
    "library(\"phyloseq\")\n",
    "\n",
    "biom95_meta <- import_biom(\"combo_otu_wMeta.biom\", parseFunction=parse_taxonomy_greengenes)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 3,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/html": [
       "<table>\n",
       "<thead><tr><th></th><th scope=col>vegcom</th><th scope=col>stream_distance</th><th scope=col>Host_genus</th><th scope=col>Host_genus_species</th><th scope=col>Library</th><th scope=col>Forest_Type</th><th scope=col>Host_species</th><th scope=col>X</th><th scope=col>Host_family</th><th scope=col>SorC</th><th scope=col>Y</th></tr></thead>\n",
       "<tbody>\n",
       "\t<tr><th scope=row>100leaf</th><td>2                                 </td><td>25.97654                          </td><td>Helicia                           </td><td>Helicia_formosana                 </td><td>L                                 </td><td>7                                 </td><td>formosana                         </td><td>183                               </td><td>Proteaceae                        </td><td>Sample                            </td><td>20                                </td></tr>\n",
       "\t<tr><th scope=row>101leaf</th><td>3                                 </td><td>18.36984                          </td><td>Helicia                           </td><td>Helicia_formosana                 </td><td>L                                 </td><td>7                                 </td><td>formosana                         </td><td>180                               </td><td>Proteaceae                        </td><td>Sample                            </td><td>27                                </td></tr>\n",
       "\t<tr><th scope=row>102leaf</th><td>3                                 </td><td>21.3725                           </td><td>Cleyera                           </td><td>Cleyera_japonica                  </td><td>L                                 </td><td>7                                 </td><td>japonica                          </td><td>187                               </td><td>Theaceae                          </td><td>Sample                            </td><td>27                                </td></tr>\n",
       "\t<tr><th scope=row>103leaf</th><td>3                                 </td><td>11.08831                          </td><td>Helicia                           </td><td>Helicia_formosana                 </td><td>L                                 </td><td>7                                 </td><td>formosana                         </td><td>180                               </td><td>Proteaceae                        </td><td>Sample                            </td><td>35                                </td></tr>\n",
       "\t<tr><th scope=row>104leaf</th><td>3                                 </td><td>1.409998                          </td><td>Helicia                           </td><td>Helicia_formosana                 </td><td>L                                 </td><td>7                                 </td><td>formosana                         </td><td>180                               </td><td>Proteaceae                        </td><td>Sample                            </td><td>51                                </td></tr>\n",
       "\t<tr><th scope=row>105leaf</th><td>3                                 </td><td>22.46722                          </td><td>Limlia                            </td><td>Limlia_uraiana                    </td><td>L                                 </td><td>7                                 </td><td>uraiana                           </td><td>180                               </td><td>Fagaceae                          </td><td>Sample                            </td><td>83                                </td></tr>\n",
       "\t<tr><th scope=row>106leaf</th><td>2                                 </td><td>82.49734                          </td><td>Helicia                           </td><td>Helicia_formosana                 </td><td>L                                 </td><td>3                                 </td><td>formosana                         </td><td>180                               </td><td>Proteaceae                        </td><td>Sample                            </td><td>147                               </td></tr>\n",
       "\t<tr><th scope=row>107leaf</th><td>1                                 </td><td>64.85876                          </td><td>Blastus                           </td><td>Blastus_cochinchinensis           </td><td>L                                 </td><td>3                                 </td><td>cochinchinensis                   </td><td>307                               </td><td>Melastomataceae                   </td><td>Sample                            </td><td>147                               </td></tr>\n",
       "\t<tr><th scope=row>108leaf</th><td>1                                 </td><td>19.02113                          </td><td>Cleyera                           </td><td>Cleyera_japonica                  </td><td>L                                 </td><td>3                                 </td><td>japonica                          </td><td>243                               </td><td>Theaceae                          </td><td>Sample                            </td><td>83                                </td></tr>\n",
       "\t<tr><th scope=row>109leaf</th><td>3                                 </td><td>13.46815                          </td><td>Meliosma                          </td><td>Meliosma_squamulata               </td><td>L                                 </td><td>7                                 </td><td>squamulata                        </td><td>209                               </td><td>Sabiaceae                         </td><td>Sample                            </td><td>49                                </td></tr>\n",
       "\t<tr><th scope=row>110leaf</th><td>3                                 </td><td>13.46815                          </td><td>Limlia                            </td><td>Limlia_uraiana                    </td><td>L                                 </td><td>7                                 </td><td>uraiana                           </td><td>209                               </td><td>Fagaceae                          </td><td>Sample                            </td><td>49                                </td></tr>\n",
       "\t<tr><th scope=row>111leaf</th><td>3                                 </td><td>20.37973                          </td><td>Limlia                            </td><td>Limlia_uraiana                    </td><td>L                                 </td><td>7                                 </td><td>uraiana                           </td><td>195                               </td><td>Fagaceae                          </td><td>Sample                            </td><td>35                                </td></tr>\n",
       "\t<tr><th scope=row>112leafA</th><td>2                                 </td><td>4.250151                          </td><td>Blastus                           </td><td>Blastus_cochinchinensis           </td><td>L                                 </td><td>7                                 </td><td>cochinchinensis                   </td><td>167                               </td><td>Melastomataceae                   </td><td>Sample                            </td><td>40                                </td></tr>\n",
       "\t<tr><th scope=row>112leafB</th><td>2                                 </td><td>4.250151                          </td><td>Blastus                           </td><td>Blastus_cochinchinensis           </td><td>L                                 </td><td>7                                 </td><td>cochinchinensis                   </td><td>167                               </td><td>Melastomataceae                   </td><td>Sample                            </td><td>40                                </td></tr>\n",
       "\t<tr><th scope=row>113leafA</th><td>3                                 </td><td>12.80385                          </td><td>Schefflera                        </td><td>Schefflera_octophylla             </td><td>L                                 </td><td>7                                 </td><td>octophylla                        </td><td>103                               </td><td>Araliaceae                        </td><td>Sample                            </td><td>40                                </td></tr>\n",
       "\t<tr><th scope=row>113leafB</th><td>3                                 </td><td>12.80385                          </td><td>Schefflera                        </td><td>Schefflera_octophylla             </td><td>L                                 </td><td>7                                 </td><td>octophylla                        </td><td>103                               </td><td>Araliaceae                        </td><td>Sample                            </td><td>40                                </td></tr>\n",
       "\t<tr><th scope=row>114leaf</th><td>2                                 </td><td>6.015914                          </td><td>Helicia                           </td><td>Helicia_formosana                 </td><td>L                                 </td><td>7                                 </td><td>formosana                         </td><td>71                                </td><td>Proteaceae                        </td><td>Sample                            </td><td>40                                </td></tr>\n",
       "\t<tr><th scope=row>115leaf</th><td>3                                 </td><td>16.75811                          </td><td>Cyathea                           </td><td>Cyathea_podophylla                </td><td>L                                 </td><td>4                                 </td><td>podophylla                        </td><td>55                                </td><td>Cyatheaceae                       </td><td>Sample                            </td><td>40                                </td></tr>\n",
       "\t<tr><th scope=row>116leaf</th><td>3                                 </td><td>24.2118                           </td><td>Helicia                           </td><td>Helicia_formosana                 </td><td>L                                 </td><td>4                                 </td><td>formosana                         </td><td>47                                </td><td>Proteaceae                        </td><td>Sample                            </td><td>40                                </td></tr>\n",
       "\t<tr><th scope=row>117leaf</th><td>3                                 </td><td>30.79582                          </td><td>Limlia                            </td><td>Limlia_uraiana                    </td><td>L                                 </td><td>7                                 </td><td>uraiana                           </td><td>40                                </td><td>Fagaceae                          </td><td>Sample                            </td><td>40                                </td></tr>\n",
       "\t<tr><th scope=row>118leaf</th><td>3                                 </td><td>30.50139                          </td><td>Limlia                            </td><td>Limlia_uraiana                    </td><td>L                                 </td><td>7                                 </td><td>uraiana                           </td><td>40                                </td><td>Fagaceae                          </td><td>Sample                            </td><td>41                                </td></tr>\n",
       "\t<tr><th scope=row>119leaf</th><td>3                                 </td><td>29.54256                          </td><td>Limlia                            </td><td>Limlia_uraiana                    </td><td>L                                 </td><td>7                                 </td><td>uraiana                           </td><td>41                                </td><td>Fagaceae                          </td><td>Sample                            </td><td>41                                </td></tr>\n",
       "\t<tr><th scope=row>120leaf</th><td>3                                 </td><td>29.84645                          </td><td>Limlia                            </td><td>Limlia_uraiana                    </td><td>L                                 </td><td>7                                 </td><td>uraiana                           </td><td>41                                </td><td>Fagaceae                          </td><td>Sample                            </td><td>40                                </td></tr>\n",
       "\t<tr><th scope=row>121leaf</th><td>3                                 </td><td>27.95829                          </td><td>Blastus                           </td><td>Blastus_cochinchinensis           </td><td>L                                 </td><td>4                                 </td><td>cochinchinensis                   </td><td>43                                </td><td>Melastomataceae                   </td><td>Sample                            </td><td>40                                </td></tr>\n",
       "\t<tr><th scope=row>122leaf</th><td>3                                 </td><td>27.07621                          </td><td>Limlia                            </td><td>Limlia_uraiana                    </td><td>L                                 </td><td>7                                 </td><td>uraiana                           </td><td>43                                </td><td>Fagaceae                          </td><td>Sample                            </td><td>43                                </td></tr>\n",
       "\t<tr><th scope=row>125leaf</th><td>3                                 </td><td>27.32744                          </td><td>Litsea                            </td><td>Litsea_acuminata                  </td><td>L                                 </td><td>4                                 </td><td>acuminata                         </td><td>40                                </td><td>Lauraceae                         </td><td>Sample                            </td><td>55                                </td></tr>\n",
       "\t<tr><th scope=row>126leafA</th><td>3                                 </td><td>20.16175                          </td><td>Blastus                           </td><td>Blastus_cochinchinensis           </td><td>L                                 </td><td>7                                 </td><td>cochinchinensis                   </td><td>40                                </td><td>Melastomataceae                   </td><td>Sample                            </td><td>71                                </td></tr>\n",
       "\t<tr><th scope=row>126leafB</th><td>3                                 </td><td>20.16175                          </td><td>Blastus                           </td><td>Blastus_cochinchinensis           </td><td>L                                 </td><td>7                                 </td><td>cochinchinensis                   </td><td>40                                </td><td>Melastomataceae                   </td><td>Sample                            </td><td>71                                </td></tr>\n",
       "\t<tr><th scope=row>127leaf</th><td>3                                 </td><td>11.69457                          </td><td>Helicia                           </td><td>Helicia_formosana                 </td><td>L                                 </td><td>7                                 </td><td>formosana                         </td><td>40                                </td><td>Proteaceae                        </td><td>Sample                            </td><td>103                               </td></tr>\n",
       "\t<tr><th scope=row>128leaf</th><td>3                                 </td><td>75.54028                          </td><td>Castanopsis                       </td><td>Castanopsis_cuspidata_var_carlesii</td><td>L                                 </td><td>3                                 </td><td>cuspidata var. carlesii           </td><td>40                                </td><td>Fagaceae                          </td><td>Sample                            </td><td>167                               </td></tr>\n",
       "\t<tr><th scope=row>⋮</th><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td></tr>\n",
       "\t<tr><th scope=row>88w</th><td>2                                 </td><td>47.36483                          </td><td>Cryptocarya                       </td><td>Cryptocarya_chinensis             </td><td>W                                 </td><td>7                                 </td><td>chinensis                         </td><td>307                               </td><td>Lauraceae                         </td><td>Sample                            </td><td>220                               </td></tr>\n",
       "\t<tr><th scope=row>89w</th><td>2                                 </td><td>25.33942                          </td><td>Helicia                           </td><td>Helicia_formosana                 </td><td>W                                 </td><td>7                                 </td><td>formosana                         </td><td>287                               </td><td>Proteaceae                        </td><td>Sample                            </td><td>20                                </td></tr>\n",
       "\t<tr><th scope=row>92w</th><td>2                                 </td><td>31.43415                          </td><td>Blastus                           </td><td>Blastus_cochinchinensis           </td><td>W                                 </td><td>7                                 </td><td>cochinchinensis                   </td><td>195                               </td><td>Melastomataceae                   </td><td>Sample                            </td><td>20                                </td></tr>\n",
       "\t<tr><th scope=row>93w</th><td>2                                 </td><td>27.63549                          </td><td>Prunus                            </td><td>Prunus_phaeosticta                </td><td>W                                 </td><td>6                                 </td><td>phaeosticta                       </td><td>187                               </td><td>Rosaceae                          </td><td>Sample                            </td><td>20                                </td></tr>\n",
       "\t<tr><th scope=row>94w</th><td>2                                 </td><td>25.06622                          </td><td>Ficus                             </td><td>Ficus_erecta_var_beecheyana       </td><td>W                                 </td><td>6                                 </td><td>erecta var. beecheyana            </td><td>180                               </td><td>Moraceae                          </td><td>Sample                            </td><td>20                                </td></tr>\n",
       "\t<tr><th scope=row>95w</th><td>2                                 </td><td>25.33385                          </td><td>Ficus                             </td><td>Ficus_erecta_var_beecheyana       </td><td>W                                 </td><td>6                                 </td><td>erecta var. beecheyana            </td><td>181                               </td><td>Moraceae                          </td><td>Sample                            </td><td>20                                </td></tr>\n",
       "\t<tr><th scope=row>96w</th><td>3                                 </td><td>24.37728                          </td><td>Helicia                           </td><td>Helicia_formosana                 </td><td>W                                 </td><td>7                                 </td><td>formosana                         </td><td>181                               </td><td>Proteaceae                        </td><td>Sample                            </td><td>21                                </td></tr>\n",
       "\t<tr><th scope=row>97w</th><td>3                                 </td><td>24.09903                          </td><td>Helicia                           </td><td>Helicia_formosana                 </td><td>W                                 </td><td>7                                 </td><td>formosana                         </td><td>180                               </td><td>Proteaceae                        </td><td>Sample                            </td><td>21                                </td></tr>\n",
       "\t<tr><th scope=row>99w</th><td>3                                 </td><td>23.19752                          </td><td>Helicia                           </td><td>Helicia_formosana                 </td><td>W                                 </td><td>7                                 </td><td>formosana                         </td><td>183                               </td><td>Proteaceae                        </td><td>Sample                            </td><td>23                                </td></tr>\n",
       "\t<tr><th scope=row>100w</th><td>2                                 </td><td>25.97654                          </td><td>Helicia                           </td><td>Helicia_formosana                 </td><td>W                                 </td><td>7                                 </td><td>formosana                         </td><td>183                               </td><td>Proteaceae                        </td><td>Sample                            </td><td>20                                </td></tr>\n",
       "\t<tr><th scope=row>101w</th><td>3                                 </td><td>18.36984                          </td><td>Helicia                           </td><td>Helicia_formosana                 </td><td>W                                 </td><td>7                                 </td><td>formosana                         </td><td>180                               </td><td>Proteaceae                        </td><td>Sample                            </td><td>27                                </td></tr>\n",
       "\t<tr><th scope=row>102w</th><td>3                                 </td><td>21.3725                           </td><td>Cleyera                           </td><td>Cleyera_japonica                  </td><td>W                                 </td><td>7                                 </td><td>japonica                          </td><td>187                               </td><td>Theaceae                          </td><td>Sample                            </td><td>27                                </td></tr>\n",
       "\t<tr><th scope=row>104w</th><td>3                                 </td><td>1.409998                          </td><td>Helicia                           </td><td>Helicia_formosana                 </td><td>W                                 </td><td>7                                 </td><td>formosana                         </td><td>180                               </td><td>Proteaceae                        </td><td>Sample                            </td><td>51                                </td></tr>\n",
       "\t<tr><th scope=row>106w</th><td>2                                 </td><td>82.49734                          </td><td>Helicia                           </td><td>Helicia_formosana                 </td><td>W                                 </td><td>3                                 </td><td>formosana                         </td><td>180                               </td><td>Proteaceae                        </td><td>Sample                            </td><td>147                               </td></tr>\n",
       "\t<tr><th scope=row>107w</th><td>1                                 </td><td>64.85876                          </td><td>Blastus                           </td><td>Blastus_cochinchinensis           </td><td>W                                 </td><td>3                                 </td><td>cochinchinensis                   </td><td>307                               </td><td>Melastomataceae                   </td><td>Sample                            </td><td>147                               </td></tr>\n",
       "\t<tr><th scope=row>108w</th><td>1                                 </td><td>19.02113                          </td><td>Cleyera                           </td><td>Cleyera_japonica                  </td><td>W                                 </td><td>3                                 </td><td>japonica                          </td><td>243                               </td><td>Theaceae                          </td><td>Sample                            </td><td>83                                </td></tr>\n",
       "\t<tr><th scope=row>109w</th><td>3                                 </td><td>13.46815                          </td><td>Meliosma                          </td><td>Meliosma_squamulata               </td><td>W                                 </td><td>7                                 </td><td>squamulata                        </td><td>209                               </td><td>Sabiaceae                         </td><td>Sample                            </td><td>49                                </td></tr>\n",
       "\t<tr><th scope=row>114w</th><td>2                                 </td><td>6.015914                          </td><td>Helicia                           </td><td>Helicia_formosana                 </td><td>W                                 </td><td>7                                 </td><td>formosana                         </td><td>71                                </td><td>Proteaceae                        </td><td>Sample                            </td><td>40                                </td></tr>\n",
       "\t<tr><th scope=row>115w</th><td>3                                 </td><td>16.75811                          </td><td>Cyathea                           </td><td>Cyathea_podophylla                </td><td>W                                 </td><td>4                                 </td><td>podophylla                        </td><td>55                                </td><td>Cyatheaceae                       </td><td>Sample                            </td><td>40                                </td></tr>\n",
       "\t<tr><th scope=row>121w</th><td>3                                 </td><td>27.95829                          </td><td>Blastus                           </td><td>Blastus_cochinchinensis           </td><td>W                                 </td><td>4                                 </td><td>cochinchinensis                   </td><td>43                                </td><td>Melastomataceae                   </td><td>Sample                            </td><td>40                                </td></tr>\n",
       "\t<tr><th scope=row>124w</th><td>3                                 </td><td>28.9161391514                     </td><td>Glochidion                        </td><td>Glochidion_acuminatum             </td><td>W                                 </td><td>7                                 </td><td>acuminatum                        </td><td>40                                </td><td>Euphorbiaceae                     </td><td>Sample                            </td><td>47                                </td></tr>\n",
       "\t<tr><th scope=row>125w</th><td>3                                 </td><td>27.32744                          </td><td>Litsea                            </td><td>Litsea_acuminata                  </td><td>W                                 </td><td>4                                 </td><td>acuminata                         </td><td>40                                </td><td>Lauraceae                         </td><td>Sample                            </td><td>55                                </td></tr>\n",
       "\t<tr><th scope=row>128w</th><td>3                                 </td><td>75.54028                          </td><td>Castanopsis                       </td><td>Castanopsis_cuspidata_var_carlesii</td><td>W                                 </td><td>3                                 </td><td>cuspidata var. carlesii           </td><td>40                                </td><td>Fagaceae                          </td><td>Sample                            </td><td>167                               </td></tr>\n",
       "\t<tr><th scope=row>129w</th><td>1                                 </td><td>105.2136                          </td><td>Myrsine                           </td><td>Myrsine_seguinii                  </td><td>W                                 </td><td>3                                 </td><td>seguinii                          </td><td>167                               </td><td>Myrsinaceae                       </td><td>Sample                            </td><td>167                               </td></tr>\n",
       "\t<tr><th scope=row>130w</th><td>3                                 </td><td>45.72196                          </td><td>Helicia                           </td><td>Helicia_formosana                 </td><td>W                                 </td><td>7                                 </td><td>formosana                         </td><td>103                               </td><td>Proteaceae                        </td><td>Sample                            </td><td>103                               </td></tr>\n",
       "\t<tr><th scope=row>131w</th><td>4                                 </td><td>5.360382                          </td><td>Helicia                           </td><td>Helicia_formosana                 </td><td>W                                 </td><td>7                                 </td><td>formosana                         </td><td>71                                </td><td>Proteaceae                        </td><td>Sample                            </td><td>71                                </td></tr>\n",
       "\t<tr><th scope=row>133w</th><td>3                                 </td><td>22.16354                          </td><td>Helicia                           </td><td>Helicia_formosana                 </td><td>W                                 </td><td>7                                 </td><td>formosana                         </td><td>47                                </td><td>Proteaceae                        </td><td>Sample                            </td><td>47                                </td></tr>\n",
       "\t<tr><th scope=row>Neg</th><td>NA                                </td><td>NA                                </td><td>NA                                </td><td>NA                                </td><td>W                                 </td><td>NA                                </td><td>NA                                </td><td>NA                                </td><td>NA                                </td><td>Control                           </td><td>NA                                </td></tr>\n",
       "\t<tr><th scope=row>PosG</th><td>NA                                </td><td>NA                                </td><td>NA                                </td><td>NA                                </td><td>W                                 </td><td>NA                                </td><td>NA                                </td><td>NA                                </td><td>NA                                </td><td>Control                           </td><td>NA                                </td></tr>\n",
       "\t<tr><th scope=row>PosI</th><td>NA                                </td><td>NA                                </td><td>NA                                </td><td>NA                                </td><td>W                                 </td><td>NA                                </td><td>NA                                </td><td>NA                                </td><td>NA                                </td><td>Control                           </td><td>NA                                </td></tr>\n",
       "</tbody>\n",
       "</table>\n"
      ],
      "text/latex": [
       "\\begin{tabular}{r|lllllllllll}\n",
       "  & vegcom & stream\\_distance & Host\\_genus & Host\\_genus\\_species & Library & Forest\\_Type & Host\\_species & X & Host\\_family & SorC & Y\\\\\n",
       "\\hline\n",
       "\t100leaf & 2                                    & 25.97654                             & Helicia                              & Helicia\\_formosana                  & L                                    & 7                                    & formosana                            & 183                                  & Proteaceae                           & Sample                               & 20                                  \\\\\n",
       "\t101leaf & 3                                    & 18.36984                             & Helicia                              & Helicia\\_formosana                  & L                                    & 7                                    & formosana                            & 180                                  & Proteaceae                           & Sample                               & 27                                  \\\\\n",
       "\t102leaf & 3                                    & 21.3725                              & Cleyera                              & Cleyera\\_japonica                   & L                                    & 7                                    & japonica                             & 187                                  & Theaceae                             & Sample                               & 27                                  \\\\\n",
       "\t103leaf & 3                                    & 11.08831                             & Helicia                              & Helicia\\_formosana                  & L                                    & 7                                    & formosana                            & 180                                  & Proteaceae                           & Sample                               & 35                                  \\\\\n",
       "\t104leaf & 3                                    & 1.409998                             & Helicia                              & Helicia\\_formosana                  & L                                    & 7                                    & formosana                            & 180                                  & Proteaceae                           & Sample                               & 51                                  \\\\\n",
       "\t105leaf & 3                                    & 22.46722                             & Limlia                               & Limlia\\_uraiana                     & L                                    & 7                                    & uraiana                              & 180                                  & Fagaceae                             & Sample                               & 83                                  \\\\\n",
       "\t106leaf & 2                                    & 82.49734                             & Helicia                              & Helicia\\_formosana                  & L                                    & 3                                    & formosana                            & 180                                  & Proteaceae                           & Sample                               & 147                                 \\\\\n",
       "\t107leaf & 1                                    & 64.85876                             & Blastus                              & Blastus\\_cochinchinensis            & L                                    & 3                                    & cochinchinensis                      & 307                                  & Melastomataceae                      & Sample                               & 147                                 \\\\\n",
       "\t108leaf & 1                                    & 19.02113                             & Cleyera                              & Cleyera\\_japonica                   & L                                    & 3                                    & japonica                             & 243                                  & Theaceae                             & Sample                               & 83                                  \\\\\n",
       "\t109leaf & 3                                    & 13.46815                             & Meliosma                             & Meliosma\\_squamulata                & L                                    & 7                                    & squamulata                           & 209                                  & Sabiaceae                            & Sample                               & 49                                  \\\\\n",
       "\t110leaf & 3                                    & 13.46815                             & Limlia                               & Limlia\\_uraiana                     & L                                    & 7                                    & uraiana                              & 209                                  & Fagaceae                             & Sample                               & 49                                  \\\\\n",
       "\t111leaf & 3                                    & 20.37973                             & Limlia                               & Limlia\\_uraiana                     & L                                    & 7                                    & uraiana                              & 195                                  & Fagaceae                             & Sample                               & 35                                  \\\\\n",
       "\t112leafA & 2                                    & 4.250151                             & Blastus                              & Blastus\\_cochinchinensis            & L                                    & 7                                    & cochinchinensis                      & 167                                  & Melastomataceae                      & Sample                               & 40                                  \\\\\n",
       "\t112leafB & 2                                    & 4.250151                             & Blastus                              & Blastus\\_cochinchinensis            & L                                    & 7                                    & cochinchinensis                      & 167                                  & Melastomataceae                      & Sample                               & 40                                  \\\\\n",
       "\t113leafA & 3                                    & 12.80385                             & Schefflera                           & Schefflera\\_octophylla              & L                                    & 7                                    & octophylla                           & 103                                  & Araliaceae                           & Sample                               & 40                                  \\\\\n",
       "\t113leafB & 3                                    & 12.80385                             & Schefflera                           & Schefflera\\_octophylla              & L                                    & 7                                    & octophylla                           & 103                                  & Araliaceae                           & Sample                               & 40                                  \\\\\n",
       "\t114leaf & 2                                    & 6.015914                             & Helicia                              & Helicia\\_formosana                  & L                                    & 7                                    & formosana                            & 71                                   & Proteaceae                           & Sample                               & 40                                  \\\\\n",
       "\t115leaf & 3                                    & 16.75811                             & Cyathea                              & Cyathea\\_podophylla                 & L                                    & 4                                    & podophylla                           & 55                                   & Cyatheaceae                          & Sample                               & 40                                  \\\\\n",
       "\t116leaf & 3                                    & 24.2118                              & Helicia                              & Helicia\\_formosana                  & L                                    & 4                                    & formosana                            & 47                                   & Proteaceae                           & Sample                               & 40                                  \\\\\n",
       "\t117leaf & 3                                    & 30.79582                             & Limlia                               & Limlia\\_uraiana                     & L                                    & 7                                    & uraiana                              & 40                                   & Fagaceae                             & Sample                               & 40                                  \\\\\n",
       "\t118leaf & 3                                    & 30.50139                             & Limlia                               & Limlia\\_uraiana                     & L                                    & 7                                    & uraiana                              & 40                                   & Fagaceae                             & Sample                               & 41                                  \\\\\n",
       "\t119leaf & 3                                    & 29.54256                             & Limlia                               & Limlia\\_uraiana                     & L                                    & 7                                    & uraiana                              & 41                                   & Fagaceae                             & Sample                               & 41                                  \\\\\n",
       "\t120leaf & 3                                    & 29.84645                             & Limlia                               & Limlia\\_uraiana                     & L                                    & 7                                    & uraiana                              & 41                                   & Fagaceae                             & Sample                               & 40                                  \\\\\n",
       "\t121leaf & 3                                    & 27.95829                             & Blastus                              & Blastus\\_cochinchinensis            & L                                    & 4                                    & cochinchinensis                      & 43                                   & Melastomataceae                      & Sample                               & 40                                  \\\\\n",
       "\t122leaf & 3                                    & 27.07621                             & Limlia                               & Limlia\\_uraiana                     & L                                    & 7                                    & uraiana                              & 43                                   & Fagaceae                             & Sample                               & 43                                  \\\\\n",
       "\t125leaf & 3                                    & 27.32744                             & Litsea                               & Litsea\\_acuminata                   & L                                    & 4                                    & acuminata                            & 40                                   & Lauraceae                            & Sample                               & 55                                  \\\\\n",
       "\t126leafA & 3                                    & 20.16175                             & Blastus                              & Blastus\\_cochinchinensis            & L                                    & 7                                    & cochinchinensis                      & 40                                   & Melastomataceae                      & Sample                               & 71                                  \\\\\n",
       "\t126leafB & 3                                    & 20.16175                             & Blastus                              & Blastus\\_cochinchinensis            & L                                    & 7                                    & cochinchinensis                      & 40                                   & Melastomataceae                      & Sample                               & 71                                  \\\\\n",
       "\t127leaf & 3                                    & 11.69457                             & Helicia                              & Helicia\\_formosana                  & L                                    & 7                                    & formosana                            & 40                                   & Proteaceae                           & Sample                               & 103                                 \\\\\n",
       "\t128leaf & 3                                        & 75.54028                                 & Castanopsis                              & Castanopsis\\_cuspidata\\_var\\_carlesii & L                                        & 3                                        & cuspidata var. carlesii                  & 40                                       & Fagaceae                                 & Sample                                   & 167                                     \\\\\n",
       "\t⋮ & ⋮ & ⋮ & ⋮ & ⋮ & ⋮ & ⋮ & ⋮ & ⋮ & ⋮ & ⋮ & ⋮\\\\\n",
       "\t88w & 2                                    & 47.36483                             & Cryptocarya                          & Cryptocarya\\_chinensis              & W                                    & 7                                    & chinensis                            & 307                                  & Lauraceae                            & Sample                               & 220                                 \\\\\n",
       "\t89w & 2                                    & 25.33942                             & Helicia                              & Helicia\\_formosana                  & W                                    & 7                                    & formosana                            & 287                                  & Proteaceae                           & Sample                               & 20                                  \\\\\n",
       "\t92w & 2                                    & 31.43415                             & Blastus                              & Blastus\\_cochinchinensis            & W                                    & 7                                    & cochinchinensis                      & 195                                  & Melastomataceae                      & Sample                               & 20                                  \\\\\n",
       "\t93w & 2                                    & 27.63549                             & Prunus                               & Prunus\\_phaeosticta                 & W                                    & 6                                    & phaeosticta                          & 187                                  & Rosaceae                             & Sample                               & 20                                  \\\\\n",
       "\t94w & 2                                        & 25.06622                                 & Ficus                                    & Ficus\\_erecta\\_var\\_beecheyana        & W                                        & 6                                        & erecta var. beecheyana                   & 180                                      & Moraceae                                 & Sample                                   & 20                                      \\\\\n",
       "\t95w & 2                                        & 25.33385                                 & Ficus                                    & Ficus\\_erecta\\_var\\_beecheyana        & W                                        & 6                                        & erecta var. beecheyana                   & 181                                      & Moraceae                                 & Sample                                   & 20                                      \\\\\n",
       "\t96w & 3                                    & 24.37728                             & Helicia                              & Helicia\\_formosana                  & W                                    & 7                                    & formosana                            & 181                                  & Proteaceae                           & Sample                               & 21                                  \\\\\n",
       "\t97w & 3                                    & 24.09903                             & Helicia                              & Helicia\\_formosana                  & W                                    & 7                                    & formosana                            & 180                                  & Proteaceae                           & Sample                               & 21                                  \\\\\n",
       "\t99w & 3                                    & 23.19752                             & Helicia                              & Helicia\\_formosana                  & W                                    & 7                                    & formosana                            & 183                                  & Proteaceae                           & Sample                               & 23                                  \\\\\n",
       "\t100w & 2                                    & 25.97654                             & Helicia                              & Helicia\\_formosana                  & W                                    & 7                                    & formosana                            & 183                                  & Proteaceae                           & Sample                               & 20                                  \\\\\n",
       "\t101w & 3                                    & 18.36984                             & Helicia                              & Helicia\\_formosana                  & W                                    & 7                                    & formosana                            & 180                                  & Proteaceae                           & Sample                               & 27                                  \\\\\n",
       "\t102w & 3                                    & 21.3725                              & Cleyera                              & Cleyera\\_japonica                   & W                                    & 7                                    & japonica                             & 187                                  & Theaceae                             & Sample                               & 27                                  \\\\\n",
       "\t104w & 3                                    & 1.409998                             & Helicia                              & Helicia\\_formosana                  & W                                    & 7                                    & formosana                            & 180                                  & Proteaceae                           & Sample                               & 51                                  \\\\\n",
       "\t106w & 2                                    & 82.49734                             & Helicia                              & Helicia\\_formosana                  & W                                    & 3                                    & formosana                            & 180                                  & Proteaceae                           & Sample                               & 147                                 \\\\\n",
       "\t107w & 1                                    & 64.85876                             & Blastus                              & Blastus\\_cochinchinensis            & W                                    & 3                                    & cochinchinensis                      & 307                                  & Melastomataceae                      & Sample                               & 147                                 \\\\\n",
       "\t108w & 1                                    & 19.02113                             & Cleyera                              & Cleyera\\_japonica                   & W                                    & 3                                    & japonica                             & 243                                  & Theaceae                             & Sample                               & 83                                  \\\\\n",
       "\t109w & 3                                    & 13.46815                             & Meliosma                             & Meliosma\\_squamulata                & W                                    & 7                                    & squamulata                           & 209                                  & Sabiaceae                            & Sample                               & 49                                  \\\\\n",
       "\t114w & 2                                    & 6.015914                             & Helicia                              & Helicia\\_formosana                  & W                                    & 7                                    & formosana                            & 71                                   & Proteaceae                           & Sample                               & 40                                  \\\\\n",
       "\t115w & 3                                    & 16.75811                             & Cyathea                              & Cyathea\\_podophylla                 & W                                    & 4                                    & podophylla                           & 55                                   & Cyatheaceae                          & Sample                               & 40                                  \\\\\n",
       "\t121w & 3                                    & 27.95829                             & Blastus                              & Blastus\\_cochinchinensis            & W                                    & 4                                    & cochinchinensis                      & 43                                   & Melastomataceae                      & Sample                               & 40                                  \\\\\n",
       "\t124w & 3                                    & 28.9161391514                        & Glochidion                           & Glochidion\\_acuminatum              & W                                    & 7                                    & acuminatum                           & 40                                   & Euphorbiaceae                        & Sample                               & 47                                  \\\\\n",
       "\t125w & 3                                    & 27.32744                             & Litsea                               & Litsea\\_acuminata                   & W                                    & 4                                    & acuminata                            & 40                                   & Lauraceae                            & Sample                               & 55                                  \\\\\n",
       "\t128w & 3                                        & 75.54028                                 & Castanopsis                              & Castanopsis\\_cuspidata\\_var\\_carlesii & W                                        & 3                                        & cuspidata var. carlesii                  & 40                                       & Fagaceae                                 & Sample                                   & 167                                     \\\\\n",
       "\t129w & 1                                    & 105.2136                             & Myrsine                              & Myrsine\\_seguinii                   & W                                    & 3                                    & seguinii                             & 167                                  & Myrsinaceae                          & Sample                               & 167                                 \\\\\n",
       "\t130w & 3                                    & 45.72196                             & Helicia                              & Helicia\\_formosana                  & W                                    & 7                                    & formosana                            & 103                                  & Proteaceae                           & Sample                               & 103                                 \\\\\n",
       "\t131w & 4                                    & 5.360382                             & Helicia                              & Helicia\\_formosana                  & W                                    & 7                                    & formosana                            & 71                                   & Proteaceae                           & Sample                               & 71                                  \\\\\n",
       "\t133w & 3                                    & 22.16354                             & Helicia                              & Helicia\\_formosana                  & W                                    & 7                                    & formosana                            & 47                                   & Proteaceae                           & Sample                               & 47                                  \\\\\n",
       "\tNeg & NA                                 & NA                                 & NA                                 & NA                                 & W                                  & NA                                 & NA                                 & NA                                 & NA                                 & Control                            & NA                                \\\\\n",
       "\tPosG & NA                                 & NA                                 & NA                                 & NA                                 & W                                  & NA                                 & NA                                 & NA                                 & NA                                 & Control                            & NA                                \\\\\n",
       "\tPosI & NA                                 & NA                                 & NA                                 & NA                                 & W                                  & NA                                 & NA                                 & NA                                 & NA                                 & Control                            & NA                                \\\\\n",
       "\\end{tabular}\n"
      ],
      "text/markdown": [
       "\n",
       "| <!--/--> | vegcom | stream_distance | Host_genus | Host_genus_species | Library | Forest_Type | Host_species | X | Host_family | SorC | Y | \n",
       "|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|\n",
       "| 100leaf | 2                                  | 25.97654                           | Helicia                            | Helicia_formosana                  | L                                  | 7                                  | formosana                          | 183                                | Proteaceae                         | Sample                             | 20                                 | \n",
       "| 101leaf | 3                                  | 18.36984                           | Helicia                            | Helicia_formosana                  | L                                  | 7                                  | formosana                          | 180                                | Proteaceae                         | Sample                             | 27                                 | \n",
       "| 102leaf | 3                                  | 21.3725                            | Cleyera                            | Cleyera_japonica                   | L                                  | 7                                  | japonica                           | 187                                | Theaceae                           | Sample                             | 27                                 | \n",
       "| 103leaf | 3                                  | 11.08831                           | Helicia                            | Helicia_formosana                  | L                                  | 7                                  | formosana                          | 180                                | Proteaceae                         | Sample                             | 35                                 | \n",
       "| 104leaf | 3                                  | 1.409998                           | Helicia                            | Helicia_formosana                  | L                                  | 7                                  | formosana                          | 180                                | Proteaceae                         | Sample                             | 51                                 | \n",
       "| 105leaf | 3                                  | 22.46722                           | Limlia                             | Limlia_uraiana                     | L                                  | 7                                  | uraiana                            | 180                                | Fagaceae                           | Sample                             | 83                                 | \n",
       "| 106leaf | 2                                  | 82.49734                           | Helicia                            | Helicia_formosana                  | L                                  | 3                                  | formosana                          | 180                                | Proteaceae                         | Sample                             | 147                                | \n",
       "| 107leaf | 1                                  | 64.85876                           | Blastus                            | Blastus_cochinchinensis            | L                                  | 3                                  | cochinchinensis                    | 307                                | Melastomataceae                    | Sample                             | 147                                | \n",
       "| 108leaf | 1                                  | 19.02113                           | Cleyera                            | Cleyera_japonica                   | L                                  | 3                                  | japonica                           | 243                                | Theaceae                           | Sample                             | 83                                 | \n",
       "| 109leaf | 3                                  | 13.46815                           | Meliosma                           | Meliosma_squamulata                | L                                  | 7                                  | squamulata                         | 209                                | Sabiaceae                          | Sample                             | 49                                 | \n",
       "| 110leaf | 3                                  | 13.46815                           | Limlia                             | Limlia_uraiana                     | L                                  | 7                                  | uraiana                            | 209                                | Fagaceae                           | Sample                             | 49                                 | \n",
       "| 111leaf | 3                                  | 20.37973                           | Limlia                             | Limlia_uraiana                     | L                                  | 7                                  | uraiana                            | 195                                | Fagaceae                           | Sample                             | 35                                 | \n",
       "| 112leafA | 2                                  | 4.250151                           | Blastus                            | Blastus_cochinchinensis            | L                                  | 7                                  | cochinchinensis                    | 167                                | Melastomataceae                    | Sample                             | 40                                 | \n",
       "| 112leafB | 2                                  | 4.250151                           | Blastus                            | Blastus_cochinchinensis            | L                                  | 7                                  | cochinchinensis                    | 167                                | Melastomataceae                    | Sample                             | 40                                 | \n",
       "| 113leafA | 3                                  | 12.80385                           | Schefflera                         | Schefflera_octophylla              | L                                  | 7                                  | octophylla                         | 103                                | Araliaceae                         | Sample                             | 40                                 | \n",
       "| 113leafB | 3                                  | 12.80385                           | Schefflera                         | Schefflera_octophylla              | L                                  | 7                                  | octophylla                         | 103                                | Araliaceae                         | Sample                             | 40                                 | \n",
       "| 114leaf | 2                                  | 6.015914                           | Helicia                            | Helicia_formosana                  | L                                  | 7                                  | formosana                          | 71                                 | Proteaceae                         | Sample                             | 40                                 | \n",
       "| 115leaf | 3                                  | 16.75811                           | Cyathea                            | Cyathea_podophylla                 | L                                  | 4                                  | podophylla                         | 55                                 | Cyatheaceae                        | Sample                             | 40                                 | \n",
       "| 116leaf | 3                                  | 24.2118                            | Helicia                            | Helicia_formosana                  | L                                  | 4                                  | formosana                          | 47                                 | Proteaceae                         | Sample                             | 40                                 | \n",
       "| 117leaf | 3                                  | 30.79582                           | Limlia                             | Limlia_uraiana                     | L                                  | 7                                  | uraiana                            | 40                                 | Fagaceae                           | Sample                             | 40                                 | \n",
       "| 118leaf | 3                                  | 30.50139                           | Limlia                             | Limlia_uraiana                     | L                                  | 7                                  | uraiana                            | 40                                 | Fagaceae                           | Sample                             | 41                                 | \n",
       "| 119leaf | 3                                  | 29.54256                           | Limlia                             | Limlia_uraiana                     | L                                  | 7                                  | uraiana                            | 41                                 | Fagaceae                           | Sample                             | 41                                 | \n",
       "| 120leaf | 3                                  | 29.84645                           | Limlia                             | Limlia_uraiana                     | L                                  | 7                                  | uraiana                            | 41                                 | Fagaceae                           | Sample                             | 40                                 | \n",
       "| 121leaf | 3                                  | 27.95829                           | Blastus                            | Blastus_cochinchinensis            | L                                  | 4                                  | cochinchinensis                    | 43                                 | Melastomataceae                    | Sample                             | 40                                 | \n",
       "| 122leaf | 3                                  | 27.07621                           | Limlia                             | Limlia_uraiana                     | L                                  | 7                                  | uraiana                            | 43                                 | Fagaceae                           | Sample                             | 43                                 | \n",
       "| 125leaf | 3                                  | 27.32744                           | Litsea                             | Litsea_acuminata                   | L                                  | 4                                  | acuminata                          | 40                                 | Lauraceae                          | Sample                             | 55                                 | \n",
       "| 126leafA | 3                                  | 20.16175                           | Blastus                            | Blastus_cochinchinensis            | L                                  | 7                                  | cochinchinensis                    | 40                                 | Melastomataceae                    | Sample                             | 71                                 | \n",
       "| 126leafB | 3                                  | 20.16175                           | Blastus                            | Blastus_cochinchinensis            | L                                  | 7                                  | cochinchinensis                    | 40                                 | Melastomataceae                    | Sample                             | 71                                 | \n",
       "| 127leaf | 3                                  | 11.69457                           | Helicia                            | Helicia_formosana                  | L                                  | 7                                  | formosana                          | 40                                 | Proteaceae                         | Sample                             | 103                                | \n",
       "| 128leaf | 3                                  | 75.54028                           | Castanopsis                        | Castanopsis_cuspidata_var_carlesii | L                                  | 3                                  | cuspidata var. carlesii            | 40                                 | Fagaceae                           | Sample                             | 167                                | \n",
       "| ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | \n",
       "| 88w | 2                                  | 47.36483                           | Cryptocarya                        | Cryptocarya_chinensis              | W                                  | 7                                  | chinensis                          | 307                                | Lauraceae                          | Sample                             | 220                                | \n",
       "| 89w | 2                                  | 25.33942                           | Helicia                            | Helicia_formosana                  | W                                  | 7                                  | formosana                          | 287                                | Proteaceae                         | Sample                             | 20                                 | \n",
       "| 92w | 2                                  | 31.43415                           | Blastus                            | Blastus_cochinchinensis            | W                                  | 7                                  | cochinchinensis                    | 195                                | Melastomataceae                    | Sample                             | 20                                 | \n",
       "| 93w | 2                                  | 27.63549                           | Prunus                             | Prunus_phaeosticta                 | W                                  | 6                                  | phaeosticta                        | 187                                | Rosaceae                           | Sample                             | 20                                 | \n",
       "| 94w | 2                                  | 25.06622                           | Ficus                              | Ficus_erecta_var_beecheyana        | W                                  | 6                                  | erecta var. beecheyana             | 180                                | Moraceae                           | Sample                             | 20                                 | \n",
       "| 95w | 2                                  | 25.33385                           | Ficus                              | Ficus_erecta_var_beecheyana        | W                                  | 6                                  | erecta var. beecheyana             | 181                                | Moraceae                           | Sample                             | 20                                 | \n",
       "| 96w | 3                                  | 24.37728                           | Helicia                            | Helicia_formosana                  | W                                  | 7                                  | formosana                          | 181                                | Proteaceae                         | Sample                             | 21                                 | \n",
       "| 97w | 3                                  | 24.09903                           | Helicia                            | Helicia_formosana                  | W                                  | 7                                  | formosana                          | 180                                | Proteaceae                         | Sample                             | 21                                 | \n",
       "| 99w | 3                                  | 23.19752                           | Helicia                            | Helicia_formosana                  | W                                  | 7                                  | formosana                          | 183                                | Proteaceae                         | Sample                             | 23                                 | \n",
       "| 100w | 2                                  | 25.97654                           | Helicia                            | Helicia_formosana                  | W                                  | 7                                  | formosana                          | 183                                | Proteaceae                         | Sample                             | 20                                 | \n",
       "| 101w | 3                                  | 18.36984                           | Helicia                            | Helicia_formosana                  | W                                  | 7                                  | formosana                          | 180                                | Proteaceae                         | Sample                             | 27                                 | \n",
       "| 102w | 3                                  | 21.3725                            | Cleyera                            | Cleyera_japonica                   | W                                  | 7                                  | japonica                           | 187                                | Theaceae                           | Sample                             | 27                                 | \n",
       "| 104w | 3                                  | 1.409998                           | Helicia                            | Helicia_formosana                  | W                                  | 7                                  | formosana                          | 180                                | Proteaceae                         | Sample                             | 51                                 | \n",
       "| 106w | 2                                  | 82.49734                           | Helicia                            | Helicia_formosana                  | W                                  | 3                                  | formosana                          | 180                                | Proteaceae                         | Sample                             | 147                                | \n",
       "| 107w | 1                                  | 64.85876                           | Blastus                            | Blastus_cochinchinensis            | W                                  | 3                                  | cochinchinensis                    | 307                                | Melastomataceae                    | Sample                             | 147                                | \n",
       "| 108w | 1                                  | 19.02113                           | Cleyera                            | Cleyera_japonica                   | W                                  | 3                                  | japonica                           | 243                                | Theaceae                           | Sample                             | 83                                 | \n",
       "| 109w | 3                                  | 13.46815                           | Meliosma                           | Meliosma_squamulata                | W                                  | 7                                  | squamulata                         | 209                                | Sabiaceae                          | Sample                             | 49                                 | \n",
       "| 114w | 2                                  | 6.015914                           | Helicia                            | Helicia_formosana                  | W                                  | 7                                  | formosana                          | 71                                 | Proteaceae                         | Sample                             | 40                                 | \n",
       "| 115w | 3                                  | 16.75811                           | Cyathea                            | Cyathea_podophylla                 | W                                  | 4                                  | podophylla                         | 55                                 | Cyatheaceae                        | Sample                             | 40                                 | \n",
       "| 121w | 3                                  | 27.95829                           | Blastus                            | Blastus_cochinchinensis            | W                                  | 4                                  | cochinchinensis                    | 43                                 | Melastomataceae                    | Sample                             | 40                                 | \n",
       "| 124w | 3                                  | 28.9161391514                      | Glochidion                         | Glochidion_acuminatum              | W                                  | 7                                  | acuminatum                         | 40                                 | Euphorbiaceae                      | Sample                             | 47                                 | \n",
       "| 125w | 3                                  | 27.32744                           | Litsea                             | Litsea_acuminata                   | W                                  | 4                                  | acuminata                          | 40                                 | Lauraceae                          | Sample                             | 55                                 | \n",
       "| 128w | 3                                  | 75.54028                           | Castanopsis                        | Castanopsis_cuspidata_var_carlesii | W                                  | 3                                  | cuspidata var. carlesii            | 40                                 | Fagaceae                           | Sample                             | 167                                | \n",
       "| 129w | 1                                  | 105.2136                           | Myrsine                            | Myrsine_seguinii                   | W                                  | 3                                  | seguinii                           | 167                                | Myrsinaceae                        | Sample                             | 167                                | \n",
       "| 130w | 3                                  | 45.72196                           | Helicia                            | Helicia_formosana                  | W                                  | 7                                  | formosana                          | 103                                | Proteaceae                         | Sample                             | 103                                | \n",
       "| 131w | 4                                  | 5.360382                           | Helicia                            | Helicia_formosana                  | W                                  | 7                                  | formosana                          | 71                                 | Proteaceae                         | Sample                             | 71                                 | \n",
       "| 133w | 3                                  | 22.16354                           | Helicia                            | Helicia_formosana                  | W                                  | 7                                  | formosana                          | 47                                 | Proteaceae                         | Sample                             | 47                                 | \n",
       "| Neg | NA                                 | NA                                 | NA                                 | NA                                 | W                                  | NA                                 | NA                                 | NA                                 | NA                                 | Control                            | NA                                 | \n",
       "| PosG | NA                                 | NA                                 | NA                                 | NA                                 | W                                  | NA                                 | NA                                 | NA                                 | NA                                 | Control                            | NA                                 | \n",
       "| PosI | NA                                 | NA                                 | NA                                 | NA                                 | W                                  | NA                                 | NA                                 | NA                                 | NA                                 | Control                            | NA                                 | \n",
       "\n",
       "\n"
      ],
      "text/plain": [
       "         vegcom stream_distance Host_genus  Host_genus_species                \n",
       "100leaf  2      25.97654        Helicia     Helicia_formosana                 \n",
       "101leaf  3      18.36984        Helicia     Helicia_formosana                 \n",
       "102leaf  3      21.3725         Cleyera     Cleyera_japonica                  \n",
       "103leaf  3      11.08831        Helicia     Helicia_formosana                 \n",
       "104leaf  3      1.409998        Helicia     Helicia_formosana                 \n",
       "105leaf  3      22.46722        Limlia      Limlia_uraiana                    \n",
       "106leaf  2      82.49734        Helicia     Helicia_formosana                 \n",
       "107leaf  1      64.85876        Blastus     Blastus_cochinchinensis           \n",
       "108leaf  1      19.02113        Cleyera     Cleyera_japonica                  \n",
       "109leaf  3      13.46815        Meliosma    Meliosma_squamulata               \n",
       "110leaf  3      13.46815        Limlia      Limlia_uraiana                    \n",
       "111leaf  3      20.37973        Limlia      Limlia_uraiana                    \n",
       "112leafA 2      4.250151        Blastus     Blastus_cochinchinensis           \n",
       "112leafB 2      4.250151        Blastus     Blastus_cochinchinensis           \n",
       "113leafA 3      12.80385        Schefflera  Schefflera_octophylla             \n",
       "113leafB 3      12.80385        Schefflera  Schefflera_octophylla             \n",
       "114leaf  2      6.015914        Helicia     Helicia_formosana                 \n",
       "115leaf  3      16.75811        Cyathea     Cyathea_podophylla                \n",
       "116leaf  3      24.2118         Helicia     Helicia_formosana                 \n",
       "117leaf  3      30.79582        Limlia      Limlia_uraiana                    \n",
       "118leaf  3      30.50139        Limlia      Limlia_uraiana                    \n",
       "119leaf  3      29.54256        Limlia      Limlia_uraiana                    \n",
       "120leaf  3      29.84645        Limlia      Limlia_uraiana                    \n",
       "121leaf  3      27.95829        Blastus     Blastus_cochinchinensis           \n",
       "122leaf  3      27.07621        Limlia      Limlia_uraiana                    \n",
       "125leaf  3      27.32744        Litsea      Litsea_acuminata                  \n",
       "126leafA 3      20.16175        Blastus     Blastus_cochinchinensis           \n",
       "126leafB 3      20.16175        Blastus     Blastus_cochinchinensis           \n",
       "127leaf  3      11.69457        Helicia     Helicia_formosana                 \n",
       "128leaf  3      75.54028        Castanopsis Castanopsis_cuspidata_var_carlesii\n",
       "⋮        ⋮      ⋮               ⋮           ⋮                                 \n",
       "88w      2      47.36483        Cryptocarya Cryptocarya_chinensis             \n",
       "89w      2      25.33942        Helicia     Helicia_formosana                 \n",
       "92w      2      31.43415        Blastus     Blastus_cochinchinensis           \n",
       "93w      2      27.63549        Prunus      Prunus_phaeosticta                \n",
       "94w      2      25.06622        Ficus       Ficus_erecta_var_beecheyana       \n",
       "95w      2      25.33385        Ficus       Ficus_erecta_var_beecheyana       \n",
       "96w      3      24.37728        Helicia     Helicia_formosana                 \n",
       "97w      3      24.09903        Helicia     Helicia_formosana                 \n",
       "99w      3      23.19752        Helicia     Helicia_formosana                 \n",
       "100w     2      25.97654        Helicia     Helicia_formosana                 \n",
       "101w     3      18.36984        Helicia     Helicia_formosana                 \n",
       "102w     3      21.3725         Cleyera     Cleyera_japonica                  \n",
       "104w     3      1.409998        Helicia     Helicia_formosana                 \n",
       "106w     2      82.49734        Helicia     Helicia_formosana                 \n",
       "107w     1      64.85876        Blastus     Blastus_cochinchinensis           \n",
       "108w     1      19.02113        Cleyera     Cleyera_japonica                  \n",
       "109w     3      13.46815        Meliosma    Meliosma_squamulata               \n",
       "114w     2      6.015914        Helicia     Helicia_formosana                 \n",
       "115w     3      16.75811        Cyathea     Cyathea_podophylla                \n",
       "121w     3      27.95829        Blastus     Blastus_cochinchinensis           \n",
       "124w     3      28.9161391514   Glochidion  Glochidion_acuminatum             \n",
       "125w     3      27.32744        Litsea      Litsea_acuminata                  \n",
       "128w     3      75.54028        Castanopsis Castanopsis_cuspidata_var_carlesii\n",
       "129w     1      105.2136        Myrsine     Myrsine_seguinii                  \n",
       "130w     3      45.72196        Helicia     Helicia_formosana                 \n",
       "131w     4      5.360382        Helicia     Helicia_formosana                 \n",
       "133w     3      22.16354        Helicia     Helicia_formosana                 \n",
       "Neg      NA     NA              NA          NA                                \n",
       "PosG     NA     NA              NA          NA                                \n",
       "PosI     NA     NA              NA          NA                                \n",
       "         Library Forest_Type Host_species            X   Host_family    \n",
       "100leaf  L       7           formosana               183 Proteaceae     \n",
       "101leaf  L       7           formosana               180 Proteaceae     \n",
       "102leaf  L       7           japonica                187 Theaceae       \n",
       "103leaf  L       7           formosana               180 Proteaceae     \n",
       "104leaf  L       7           formosana               180 Proteaceae     \n",
       "105leaf  L       7           uraiana                 180 Fagaceae       \n",
       "106leaf  L       3           formosana               180 Proteaceae     \n",
       "107leaf  L       3           cochinchinensis         307 Melastomataceae\n",
       "108leaf  L       3           japonica                243 Theaceae       \n",
       "109leaf  L       7           squamulata              209 Sabiaceae      \n",
       "110leaf  L       7           uraiana                 209 Fagaceae       \n",
       "111leaf  L       7           uraiana                 195 Fagaceae       \n",
       "112leafA L       7           cochinchinensis         167 Melastomataceae\n",
       "112leafB L       7           cochinchinensis         167 Melastomataceae\n",
       "113leafA L       7           octophylla              103 Araliaceae     \n",
       "113leafB L       7           octophylla              103 Araliaceae     \n",
       "114leaf  L       7           formosana               71  Proteaceae     \n",
       "115leaf  L       4           podophylla              55  Cyatheaceae    \n",
       "116leaf  L       4           formosana               47  Proteaceae     \n",
       "117leaf  L       7           uraiana                 40  Fagaceae       \n",
       "118leaf  L       7           uraiana                 40  Fagaceae       \n",
       "119leaf  L       7           uraiana                 41  Fagaceae       \n",
       "120leaf  L       7           uraiana                 41  Fagaceae       \n",
       "121leaf  L       4           cochinchinensis         43  Melastomataceae\n",
       "122leaf  L       7           uraiana                 43  Fagaceae       \n",
       "125leaf  L       4           acuminata               40  Lauraceae      \n",
       "126leafA L       7           cochinchinensis         40  Melastomataceae\n",
       "126leafB L       7           cochinchinensis         40  Melastomataceae\n",
       "127leaf  L       7           formosana               40  Proteaceae     \n",
       "128leaf  L       3           cuspidata var. carlesii 40  Fagaceae       \n",
       "⋮        ⋮       ⋮           ⋮                       ⋮   ⋮              \n",
       "88w      W       7           chinensis               307 Lauraceae      \n",
       "89w      W       7           formosana               287 Proteaceae     \n",
       "92w      W       7           cochinchinensis         195 Melastomataceae\n",
       "93w      W       6           phaeosticta             187 Rosaceae       \n",
       "94w      W       6           erecta var. beecheyana  180 Moraceae       \n",
       "95w      W       6           erecta var. beecheyana  181 Moraceae       \n",
       "96w      W       7           formosana               181 Proteaceae     \n",
       "97w      W       7           formosana               180 Proteaceae     \n",
       "99w      W       7           formosana               183 Proteaceae     \n",
       "100w     W       7           formosana               183 Proteaceae     \n",
       "101w     W       7           formosana               180 Proteaceae     \n",
       "102w     W       7           japonica                187 Theaceae       \n",
       "104w     W       7           formosana               180 Proteaceae     \n",
       "106w     W       3           formosana               180 Proteaceae     \n",
       "107w     W       3           cochinchinensis         307 Melastomataceae\n",
       "108w     W       3           japonica                243 Theaceae       \n",
       "109w     W       7           squamulata              209 Sabiaceae      \n",
       "114w     W       7           formosana               71  Proteaceae     \n",
       "115w     W       4           podophylla              55  Cyatheaceae    \n",
       "121w     W       4           cochinchinensis         43  Melastomataceae\n",
       "124w     W       7           acuminatum              40  Euphorbiaceae  \n",
       "125w     W       4           acuminata               40  Lauraceae      \n",
       "128w     W       3           cuspidata var. carlesii 40  Fagaceae       \n",
       "129w     W       3           seguinii                167 Myrsinaceae    \n",
       "130w     W       7           formosana               103 Proteaceae     \n",
       "131w     W       7           formosana               71  Proteaceae     \n",
       "133w     W       7           formosana               47  Proteaceae     \n",
       "Neg      W       NA          NA                      NA  NA             \n",
       "PosG     W       NA          NA                      NA  NA             \n",
       "PosI     W       NA          NA                      NA  NA             \n",
       "         SorC    Y  \n",
       "100leaf  Sample  20 \n",
       "101leaf  Sample  27 \n",
       "102leaf  Sample  27 \n",
       "103leaf  Sample  35 \n",
       "104leaf  Sample  51 \n",
       "105leaf  Sample  83 \n",
       "106leaf  Sample  147\n",
       "107leaf  Sample  147\n",
       "108leaf  Sample  83 \n",
       "109leaf  Sample  49 \n",
       "110leaf  Sample  49 \n",
       "111leaf  Sample  35 \n",
       "112leafA Sample  40 \n",
       "112leafB Sample  40 \n",
       "113leafA Sample  40 \n",
       "113leafB Sample  40 \n",
       "114leaf  Sample  40 \n",
       "115leaf  Sample  40 \n",
       "116leaf  Sample  40 \n",
       "117leaf  Sample  40 \n",
       "118leaf  Sample  41 \n",
       "119leaf  Sample  41 \n",
       "120leaf  Sample  40 \n",
       "121leaf  Sample  40 \n",
       "122leaf  Sample  43 \n",
       "125leaf  Sample  55 \n",
       "126leafA Sample  71 \n",
       "126leafB Sample  71 \n",
       "127leaf  Sample  103\n",
       "128leaf  Sample  167\n",
       "⋮        ⋮       ⋮  \n",
       "88w      Sample  220\n",
       "89w      Sample  20 \n",
       "92w      Sample  20 \n",
       "93w      Sample  20 \n",
       "94w      Sample  20 \n",
       "95w      Sample  20 \n",
       "96w      Sample  21 \n",
       "97w      Sample  21 \n",
       "99w      Sample  23 \n",
       "100w     Sample  20 \n",
       "101w     Sample  27 \n",
       "102w     Sample  27 \n",
       "104w     Sample  51 \n",
       "106w     Sample  147\n",
       "107w     Sample  147\n",
       "108w     Sample  83 \n",
       "109w     Sample  49 \n",
       "114w     Sample  40 \n",
       "115w     Sample  40 \n",
       "121w     Sample  40 \n",
       "124w     Sample  47 \n",
       "125w     Sample  55 \n",
       "128w     Sample  167\n",
       "129w     Sample  167\n",
       "130w     Sample  103\n",
       "131w     Sample  71 \n",
       "133w     Sample  47 \n",
       "Neg      Control NA \n",
       "PosG     Control NA \n",
       "PosI     Control NA "
      ]
     },
     "metadata": {},
     "output_type": "display_data"
    }
   ],
   "source": [
    "sample_data(biom95_meta)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 4,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/html": [
       "<table>\n",
       "<thead><tr><th></th><th scope=col>100leaf</th><th scope=col>101leaf</th><th scope=col>102leaf</th><th scope=col>103leaf</th><th scope=col>104leaf</th><th scope=col>105leaf</th><th scope=col>106leaf</th><th scope=col>107leaf</th><th scope=col>108leaf</th><th scope=col>109leaf</th><th scope=col>⋯</th><th scope=col>124w</th><th scope=col>125w</th><th scope=col>128w</th><th scope=col>129w</th><th scope=col>130w</th><th scope=col>131w</th><th scope=col>133w</th><th scope=col>Neg</th><th scope=col>PosG</th><th scope=col>PosI</th></tr></thead>\n",
       "<tbody>\n",
       "\t<tr><th scope=row>OTU19:100leaf</th><td>81511</td><td>  178</td><td>  0  </td><td>1145 </td><td>    3</td><td>   0 </td><td>0    </td><td>   0 </td><td>  0  </td><td>   0 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU108:100leaf</th><td>26184</td><td>    0</td><td>  0  </td><td>   7 </td><td> 3504</td><td>   0 </td><td>0    </td><td>   0 </td><td>  0  </td><td>   0 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU1:100leaf</th><td> 2735</td><td> 6795</td><td>586  </td><td>4290 </td><td> 2898</td><td>5424 </td><td>1    </td><td>   3 </td><td>859  </td><td> 504 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU202:100leaf</th><td> 3214</td><td>    0</td><td>  0  </td><td>6330 </td><td>    1</td><td>   0 </td><td>0    </td><td>   0 </td><td>  0  </td><td>   0 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU426:100leaf</th><td> 5943</td><td>    0</td><td>  0  </td><td>   0 </td><td>   38</td><td>   0 </td><td>0    </td><td>   0 </td><td>  0  </td><td>   0 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU1905:100leaf</th><td>   98</td><td>    0</td><td> 71  </td><td>  35 </td><td>    0</td><td>   0 </td><td>0    </td><td>   0 </td><td>  0  </td><td>   0 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU10:100leaf</th><td> 6618</td><td>22297</td><td> 36  </td><td>6276 </td><td>12852</td><td>6258 </td><td>1    </td><td>   0 </td><td>  1  </td><td>  81 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU10433:17leaf</th><td>    1</td><td>    0</td><td>  0  </td><td>   1 </td><td>    0</td><td>   0 </td><td>0    </td><td>   0 </td><td>  0  </td><td>   0 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU17:100leaf</th><td> 2877</td><td> 2600</td><td>  6  </td><td>3782 </td><td> 5298</td><td> 491 </td><td>0    </td><td>   0 </td><td> 51  </td><td>   2 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU429:100leaf</th><td>  559</td><td>    0</td><td>  0  </td><td>   0 </td><td>    0</td><td>   0 </td><td>0    </td><td>   0 </td><td>  0  </td><td>   0 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU15:100leaf</th><td> 5135</td><td> 7376</td><td>233  </td><td> 749 </td><td> 1478</td><td>2849 </td><td>0    </td><td>   0 </td><td>220  </td><td> 557 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU27:100leaf</th><td>  168</td><td>  174</td><td>  0  </td><td> 386 </td><td>  622</td><td> 314 </td><td>0    </td><td>   0 </td><td>354  </td><td>  53 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU355:100leaf</th><td>  313</td><td>  143</td><td>  0  </td><td>  95 </td><td>  207</td><td>  37 </td><td>0    </td><td>   0 </td><td> 18  </td><td>   9 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU8266:104leaf</th><td>    2</td><td>    0</td><td>  0  </td><td>   0 </td><td>    7</td><td>   0 </td><td>0    </td><td>   0 </td><td>  0  </td><td>   0 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU22:101leaf</th><td>  112</td><td> 7736</td><td> 25  </td><td>2534 </td><td>    1</td><td>   0 </td><td>0    </td><td>   0 </td><td>  0  </td><td>   0 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU91:100leaf</th><td>  117</td><td>  111</td><td>  0  </td><td> 308 </td><td>  360</td><td>  15 </td><td>0    </td><td>   0 </td><td>  0  </td><td>   0 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU570:100leaf</th><td>   38</td><td>   25</td><td>  0  </td><td>   1 </td><td>  121</td><td>   0 </td><td>0    </td><td>   0 </td><td>  0  </td><td>   0 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU406:100leaf</th><td>   99</td><td>  209</td><td>165  </td><td> 138 </td><td>  235</td><td>   0 </td><td>0    </td><td>   0 </td><td>  0  </td><td> 332 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU181:100leaf</th><td>  416</td><td> 2217</td><td>273  </td><td> 615 </td><td>  587</td><td>  78 </td><td>0    </td><td>2513 </td><td>  0  </td><td>1962 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU520:100leaf</th><td>   73</td><td>    0</td><td>  0  </td><td>   0 </td><td>    0</td><td>   0 </td><td>0    </td><td>   0 </td><td>  0  </td><td>  75 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU73:100leaf</th><td>   65</td><td>  217</td><td> 53  </td><td> 117 </td><td>  442</td><td> 560 </td><td>1    </td><td>   0 </td><td>325  </td><td>   0 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU159:100leaf</th><td>   45</td><td>  102</td><td> 63  </td><td>  37 </td><td>  123</td><td> 154 </td><td>0    </td><td> 568 </td><td>174  </td><td>  67 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU794:16leaf</th><td>  124</td><td>    0</td><td>  0  </td><td>   0 </td><td>    0</td><td> 249 </td><td>0    </td><td>   0 </td><td>  0  </td><td>   0 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU297:100leaf</th><td>   35</td><td>    0</td><td>  0  </td><td>   0 </td><td>  101</td><td>   0 </td><td>0    </td><td>   0 </td><td>  0  </td><td>  66 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU252:117leaf</th><td>  140</td><td>    0</td><td>157  </td><td>  55 </td><td>  127</td><td>   0 </td><td>0    </td><td>   0 </td><td>  0  </td><td> 186 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU1199:41leaf</th><td>   33</td><td>    0</td><td>  0  </td><td>   0 </td><td>   40</td><td>   0 </td><td>0    </td><td>   0 </td><td>  0  </td><td>   0 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU951:14leaf</th><td>   68</td><td>  346</td><td> 34  </td><td>   0 </td><td>    0</td><td>   0 </td><td>0    </td><td>   0 </td><td>  0  </td><td>   0 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU3434:50leaf</th><td>   16</td><td>    0</td><td>  0  </td><td>   0 </td><td>    0</td><td>   0 </td><td>0    </td><td>   0 </td><td>  0  </td><td>   0 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU412:102leaf</th><td>    8</td><td>    0</td><td> 18  </td><td>  24 </td><td>   47</td><td>   0 </td><td>0    </td><td>   0 </td><td>  0  </td><td>   0 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>OTU78:100leaf</th><td>  104</td><td> 6942</td><td>512  </td><td>1502 </td><td> 4396</td><td>   0 </td><td>0    </td><td>   0 </td><td>  0  </td><td>2831 </td><td>⋯    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td><td>0    </td></tr>\n",
       "\t<tr><th scope=row>⋮</th><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋱</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td><td>⋮</td></tr>\n",
       "\t<tr><th scope=row>OTU6747:131w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>20 </td><td>  0</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU6000:131w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>32 </td><td>  0</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU6968:131w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>16 </td><td>  0</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU9675:131w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>33 </td><td>  0</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU6715:131w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>19 </td><td>  0</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU6054:131w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>29 </td><td>  0</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU12242:131w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 2 </td><td>  0</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU1516:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td>584</td><td>0  </td><td>1  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU1866:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td>498</td><td>0  </td><td>1  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU3982:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td> 75</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU5749:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td> 34</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU5806:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td> 36</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU4262:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td> 70</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU6274:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td> 26</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU4545:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td> 52</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU6207:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td> 27</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU5571:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td> 34</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU5846:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td> 30</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU7547:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td> 20</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU8051:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td> 13</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU5867:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td> 34</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU5677:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td> 42</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU5575:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td> 31</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU4445:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td> 56</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU6203:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td> 26</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU7934:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td> 20</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU7163:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td> 18</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU12203:133w</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td>  2</td><td>0  </td><td>0  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU12502:PosG</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td>  0</td><td>0  </td><td>2  </td><td>0  </td></tr>\n",
       "\t<tr><th scope=row>OTU12503:PosG</th><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>⋯  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td>0  </td><td> 0 </td><td>  0</td><td>0  </td><td>1  </td><td>1  </td></tr>\n",
       "</tbody>\n",
       "</table>\n"
      ],
      "text/latex": [
       "\\begin{tabular}{r|llllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllll}\n",
       "  & 100leaf & 101leaf & 102leaf & 103leaf & 104leaf & 105leaf & 106leaf & 107leaf & 108leaf & 109leaf & ⋯ & 124w & 125w & 128w & 129w & 130w & 131w & 133w & Neg & PosG & PosI\\\\\n",
       "\\hline\n",
       "\tOTU19:100leaf & 81511 &   178 &   0   & 1145  &     3 &    0  & 0     &    0  &   0   &    0  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU108:100leaf & 26184 &     0 &   0   &    7  &  3504 &    0  & 0     &    0  &   0   &    0  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU1:100leaf &  2735 &  6795 & 586   & 4290  &  2898 & 5424  & 1     &    3  & 859   &  504  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU202:100leaf &  3214 &     0 &   0   & 6330  &     1 &    0  & 0     &    0  &   0   &    0  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU426:100leaf &  5943 &     0 &   0   &    0  &    38 &    0  & 0     &    0  &   0   &    0  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU1905:100leaf &    98 &     0 &  71   &   35  &     0 &    0  & 0     &    0  &   0   &    0  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU10:100leaf &  6618 & 22297 &  36   & 6276  & 12852 & 6258  & 1     &    0  &   1   &   81  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU10433:17leaf &     1 &     0 &   0   &    1  &     0 &    0  & 0     &    0  &   0   &    0  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU17:100leaf &  2877 &  2600 &   6   & 3782  &  5298 &  491  & 0     &    0  &  51   &    2  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU429:100leaf &   559 &     0 &   0   &    0  &     0 &    0  & 0     &    0  &   0   &    0  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU15:100leaf &  5135 &  7376 & 233   &  749  &  1478 & 2849  & 0     &    0  & 220   &  557  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU27:100leaf &   168 &   174 &   0   &  386  &   622 &  314  & 0     &    0  & 354   &   53  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU355:100leaf &   313 &   143 &   0   &   95  &   207 &   37  & 0     &    0  &  18   &    9  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU8266:104leaf &     2 &     0 &   0   &    0  &     7 &    0  & 0     &    0  &   0   &    0  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU22:101leaf &   112 &  7736 &  25   & 2534  &     1 &    0  & 0     &    0  &   0   &    0  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU91:100leaf &   117 &   111 &   0   &  308  &   360 &   15  & 0     &    0  &   0   &    0  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU570:100leaf &    38 &    25 &   0   &    1  &   121 &    0  & 0     &    0  &   0   &    0  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU406:100leaf &    99 &   209 & 165   &  138  &   235 &    0  & 0     &    0  &   0   &  332  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU181:100leaf &   416 &  2217 & 273   &  615  &   587 &   78  & 0     & 2513  &   0   & 1962  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU520:100leaf &    73 &     0 &   0   &    0  &     0 &    0  & 0     &    0  &   0   &   75  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU73:100leaf &    65 &   217 &  53   &  117  &   442 &  560  & 1     &    0  & 325   &    0  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU159:100leaf &    45 &   102 &  63   &   37  &   123 &  154  & 0     &  568  & 174   &   67  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU794:16leaf &   124 &     0 &   0   &    0  &     0 &  249  & 0     &    0  &   0   &    0  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU297:100leaf &    35 &     0 &   0   &    0  &   101 &    0  & 0     &    0  &   0   &   66  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU252:117leaf &   140 &     0 & 157   &   55  &   127 &    0  & 0     &    0  &   0   &  186  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU1199:41leaf &    33 &     0 &   0   &    0  &    40 &    0  & 0     &    0  &   0   &    0  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU951:14leaf &    68 &   346 &  34   &    0  &     0 &    0  & 0     &    0  &   0   &    0  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU3434:50leaf &    16 &     0 &   0   &    0  &     0 &    0  & 0     &    0  &   0   &    0  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU412:102leaf &     8 &     0 &  18   &   24  &    47 &    0  & 0     &    0  &   0   &    0  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\tOTU78:100leaf &   104 &  6942 & 512   & 1502  &  4396 &    0  & 0     &    0  &   0   & 2831  & ⋯     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0     & 0    \\\\\n",
       "\t⋮ & ⋮ & ⋮ & ⋮ & ⋮ & ⋮ & ⋮ & ⋮ & ⋮ & ⋮ & ⋮ & ⋱ & ⋮ & ⋮ & ⋮ & ⋮ & ⋮ & ⋮ & ⋮ & ⋮ & ⋮ & ⋮\\\\\n",
       "\tOTU6747:131w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   & 20  &   0 & 0   & 0   & 0  \\\\\n",
       "\tOTU6000:131w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   & 32  &   0 & 0   & 0   & 0  \\\\\n",
       "\tOTU6968:131w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   & 16  &   0 & 0   & 0   & 0  \\\\\n",
       "\tOTU9675:131w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   & 33  &   0 & 0   & 0   & 0  \\\\\n",
       "\tOTU6715:131w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   & 19  &   0 & 0   & 0   & 0  \\\\\n",
       "\tOTU6054:131w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   & 29  &   0 & 0   & 0   & 0  \\\\\n",
       "\tOTU12242:131w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  2  &   0 & 0   & 0   & 0  \\\\\n",
       "\tOTU1516:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  & 584 & 0   & 1   & 0  \\\\\n",
       "\tOTU1866:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  & 498 & 0   & 1   & 0  \\\\\n",
       "\tOTU3982:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &  75 & 0   & 0   & 0  \\\\\n",
       "\tOTU5749:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &  34 & 0   & 0   & 0  \\\\\n",
       "\tOTU5806:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &  36 & 0   & 0   & 0  \\\\\n",
       "\tOTU4262:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &  70 & 0   & 0   & 0  \\\\\n",
       "\tOTU6274:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &  26 & 0   & 0   & 0  \\\\\n",
       "\tOTU4545:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &  52 & 0   & 0   & 0  \\\\\n",
       "\tOTU6207:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &  27 & 0   & 0   & 0  \\\\\n",
       "\tOTU5571:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &  34 & 0   & 0   & 0  \\\\\n",
       "\tOTU5846:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &  30 & 0   & 0   & 0  \\\\\n",
       "\tOTU7547:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &  20 & 0   & 0   & 0  \\\\\n",
       "\tOTU8051:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &  13 & 0   & 0   & 0  \\\\\n",
       "\tOTU5867:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &  34 & 0   & 0   & 0  \\\\\n",
       "\tOTU5677:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &  42 & 0   & 0   & 0  \\\\\n",
       "\tOTU5575:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &  31 & 0   & 0   & 0  \\\\\n",
       "\tOTU4445:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &  56 & 0   & 0   & 0  \\\\\n",
       "\tOTU6203:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &  26 & 0   & 0   & 0  \\\\\n",
       "\tOTU7934:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &  20 & 0   & 0   & 0  \\\\\n",
       "\tOTU7163:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &  18 & 0   & 0   & 0  \\\\\n",
       "\tOTU12203:133w & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &   2 & 0   & 0   & 0  \\\\\n",
       "\tOTU12502:PosG & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &   0 & 0   & 2   & 0  \\\\\n",
       "\tOTU12503:PosG & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & 0   & ⋯   & 0   & 0   & 0   & 0   & 0   &  0  &   0 & 0   & 1   & 1  \\\\\n",
       "\\end{tabular}\n"
      ],
      "text/markdown": [
       "\n",
       "| <!--/--> | 100leaf | 101leaf | 102leaf | 103leaf | 104leaf | 105leaf | 106leaf | 107leaf | 108leaf | 109leaf | ⋯ | 124w | 125w | 128w | 129w | 130w | 131w | 133w | Neg | PosG | PosI | \n",
       "|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|\n",
       "| OTU19:100leaf | 81511 |   178 |   0   | 1145  |     3 |    0  | 0     |    0  |   0   |    0  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU108:100leaf | 26184 |     0 |   0   |    7  |  3504 |    0  | 0     |    0  |   0   |    0  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU1:100leaf |  2735 |  6795 | 586   | 4290  |  2898 | 5424  | 1     |    3  | 859   |  504  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU202:100leaf |  3214 |     0 |   0   | 6330  |     1 |    0  | 0     |    0  |   0   |    0  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU426:100leaf |  5943 |     0 |   0   |    0  |    38 |    0  | 0     |    0  |   0   |    0  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU1905:100leaf |    98 |     0 |  71   |   35  |     0 |    0  | 0     |    0  |   0   |    0  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU10:100leaf |  6618 | 22297 |  36   | 6276  | 12852 | 6258  | 1     |    0  |   1   |   81  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU10433:17leaf |     1 |     0 |   0   |    1  |     0 |    0  | 0     |    0  |   0   |    0  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU17:100leaf |  2877 |  2600 |   6   | 3782  |  5298 |  491  | 0     |    0  |  51   |    2  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU429:100leaf |   559 |     0 |   0   |    0  |     0 |    0  | 0     |    0  |   0   |    0  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU15:100leaf |  5135 |  7376 | 233   |  749  |  1478 | 2849  | 0     |    0  | 220   |  557  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU27:100leaf |   168 |   174 |   0   |  386  |   622 |  314  | 0     |    0  | 354   |   53  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU355:100leaf |   313 |   143 |   0   |   95  |   207 |   37  | 0     |    0  |  18   |    9  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU8266:104leaf |     2 |     0 |   0   |    0  |     7 |    0  | 0     |    0  |   0   |    0  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU22:101leaf |   112 |  7736 |  25   | 2534  |     1 |    0  | 0     |    0  |   0   |    0  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU91:100leaf |   117 |   111 |   0   |  308  |   360 |   15  | 0     |    0  |   0   |    0  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU570:100leaf |    38 |    25 |   0   |    1  |   121 |    0  | 0     |    0  |   0   |    0  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU406:100leaf |    99 |   209 | 165   |  138  |   235 |    0  | 0     |    0  |   0   |  332  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU181:100leaf |   416 |  2217 | 273   |  615  |   587 |   78  | 0     | 2513  |   0   | 1962  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU520:100leaf |    73 |     0 |   0   |    0  |     0 |    0  | 0     |    0  |   0   |   75  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU73:100leaf |    65 |   217 |  53   |  117  |   442 |  560  | 1     |    0  | 325   |    0  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU159:100leaf |    45 |   102 |  63   |   37  |   123 |  154  | 0     |  568  | 174   |   67  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU794:16leaf |   124 |     0 |   0   |    0  |     0 |  249  | 0     |    0  |   0   |    0  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU297:100leaf |    35 |     0 |   0   |    0  |   101 |    0  | 0     |    0  |   0   |   66  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU252:117leaf |   140 |     0 | 157   |   55  |   127 |    0  | 0     |    0  |   0   |  186  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU1199:41leaf |    33 |     0 |   0   |    0  |    40 |    0  | 0     |    0  |   0   |    0  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU951:14leaf |    68 |   346 |  34   |    0  |     0 |    0  | 0     |    0  |   0   |    0  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU3434:50leaf |    16 |     0 |   0   |    0  |     0 |    0  | 0     |    0  |   0   |    0  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU412:102leaf |     8 |     0 |  18   |   24  |    47 |    0  | 0     |    0  |   0   |    0  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| OTU78:100leaf |   104 |  6942 | 512   | 1502  |  4396 |    0  | 0     |    0  |   0   | 2831  | ⋯     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | 0     | \n",
       "| ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋱ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | \n",
       "| OTU6747:131w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   | 20  |   0 | 0   | 0   | 0   | \n",
       "| OTU6000:131w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   | 32  |   0 | 0   | 0   | 0   | \n",
       "| OTU6968:131w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   | 16  |   0 | 0   | 0   | 0   | \n",
       "| OTU9675:131w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   | 33  |   0 | 0   | 0   | 0   | \n",
       "| OTU6715:131w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   | 19  |   0 | 0   | 0   | 0   | \n",
       "| OTU6054:131w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   | 29  |   0 | 0   | 0   | 0   | \n",
       "| OTU12242:131w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  2  |   0 | 0   | 0   | 0   | \n",
       "| OTU1516:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  | 584 | 0   | 1   | 0   | \n",
       "| OTU1866:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  | 498 | 0   | 1   | 0   | \n",
       "| OTU3982:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |  75 | 0   | 0   | 0   | \n",
       "| OTU5749:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |  34 | 0   | 0   | 0   | \n",
       "| OTU5806:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |  36 | 0   | 0   | 0   | \n",
       "| OTU4262:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |  70 | 0   | 0   | 0   | \n",
       "| OTU6274:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |  26 | 0   | 0   | 0   | \n",
       "| OTU4545:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |  52 | 0   | 0   | 0   | \n",
       "| OTU6207:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |  27 | 0   | 0   | 0   | \n",
       "| OTU5571:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |  34 | 0   | 0   | 0   | \n",
       "| OTU5846:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |  30 | 0   | 0   | 0   | \n",
       "| OTU7547:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |  20 | 0   | 0   | 0   | \n",
       "| OTU8051:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |  13 | 0   | 0   | 0   | \n",
       "| OTU5867:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |  34 | 0   | 0   | 0   | \n",
       "| OTU5677:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |  42 | 0   | 0   | 0   | \n",
       "| OTU5575:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |  31 | 0   | 0   | 0   | \n",
       "| OTU4445:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |  56 | 0   | 0   | 0   | \n",
       "| OTU6203:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |  26 | 0   | 0   | 0   | \n",
       "| OTU7934:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |  20 | 0   | 0   | 0   | \n",
       "| OTU7163:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |  18 | 0   | 0   | 0   | \n",
       "| OTU12203:133w | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |   2 | 0   | 0   | 0   | \n",
       "| OTU12502:PosG | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |   0 | 0   | 2   | 0   | \n",
       "| OTU12503:PosG | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | 0   | ⋯   | 0   | 0   | 0   | 0   | 0   |  0  |   0 | 0   | 1   | 1   | \n",
       "\n",
       "\n"
      ],
      "text/plain": [
       "                100leaf 101leaf 102leaf 103leaf 104leaf 105leaf 106leaf 107leaf\n",
       "OTU19:100leaf   81511     178     0     1145        3      0    0          0   \n",
       "OTU108:100leaf  26184       0     0        7     3504      0    0          0   \n",
       "OTU1:100leaf     2735    6795   586     4290     2898   5424    1          3   \n",
       "OTU202:100leaf   3214       0     0     6330        1      0    0          0   \n",
       "OTU426:100leaf   5943       0     0        0       38      0    0          0   \n",
       "OTU1905:100leaf    98       0    71       35        0      0    0          0   \n",
       "OTU10:100leaf    6618   22297    36     6276    12852   6258    1          0   \n",
       "OTU10433:17leaf     1       0     0        1        0      0    0          0   \n",
       "OTU17:100leaf    2877    2600     6     3782     5298    491    0          0   \n",
       "OTU429:100leaf    559       0     0        0        0      0    0          0   \n",
       "OTU15:100leaf    5135    7376   233      749     1478   2849    0          0   \n",
       "OTU27:100leaf     168     174     0      386      622    314    0          0   \n",
       "OTU355:100leaf    313     143     0       95      207     37    0          0   \n",
       "OTU8266:104leaf     2       0     0        0        7      0    0          0   \n",
       "OTU22:101leaf     112    7736    25     2534        1      0    0          0   \n",
       "OTU91:100leaf     117     111     0      308      360     15    0          0   \n",
       "OTU570:100leaf     38      25     0        1      121      0    0          0   \n",
       "OTU406:100leaf     99     209   165      138      235      0    0          0   \n",
       "OTU181:100leaf    416    2217   273      615      587     78    0       2513   \n",
       "OTU520:100leaf     73       0     0        0        0      0    0          0   \n",
       "OTU73:100leaf      65     217    53      117      442    560    1          0   \n",
       "OTU159:100leaf     45     102    63       37      123    154    0        568   \n",
       "OTU794:16leaf     124       0     0        0        0    249    0          0   \n",
       "OTU297:100leaf     35       0     0        0      101      0    0          0   \n",
       "OTU252:117leaf    140       0   157       55      127      0    0          0   \n",
       "OTU1199:41leaf     33       0     0        0       40      0    0          0   \n",
       "OTU951:14leaf      68     346    34        0        0      0    0          0   \n",
       "OTU3434:50leaf     16       0     0        0        0      0    0          0   \n",
       "OTU412:102leaf      8       0    18       24       47      0    0          0   \n",
       "OTU78:100leaf     104    6942   512     1502     4396      0    0          0   \n",
       "⋮               ⋮       ⋮       ⋮       ⋮       ⋮       ⋮       ⋮       ⋮      \n",
       "OTU6747:131w    0       0       0       0       0       0       0       0      \n",
       "OTU6000:131w    0       0       0       0       0       0       0       0      \n",
       "OTU6968:131w    0       0       0       0       0       0       0       0      \n",
       "OTU9675:131w    0       0       0       0       0       0       0       0      \n",
       "OTU6715:131w    0       0       0       0       0       0       0       0      \n",
       "OTU6054:131w    0       0       0       0       0       0       0       0      \n",
       "OTU12242:131w   0       0       0       0       0       0       0       0      \n",
       "OTU1516:133w    0       0       0       0       0       0       0       0      \n",
       "OTU1866:133w    0       0       0       0       0       0       0       0      \n",
       "OTU3982:133w    0       0       0       0       0       0       0       0      \n",
       "OTU5749:133w    0       0       0       0       0       0       0       0      \n",
       "OTU5806:133w    0       0       0       0       0       0       0       0      \n",
       "OTU4262:133w    0       0       0       0       0       0       0       0      \n",
       "OTU6274:133w    0       0       0       0       0       0       0       0      \n",
       "OTU4545:133w    0       0       0       0       0       0       0       0      \n",
       "OTU6207:133w    0       0       0       0       0       0       0       0      \n",
       "OTU5571:133w    0       0       0       0       0       0       0       0      \n",
       "OTU5846:133w    0       0       0       0       0       0       0       0      \n",
       "OTU7547:133w    0       0       0       0       0       0       0       0      \n",
       "OTU8051:133w    0       0       0       0       0       0       0       0      \n",
       "OTU5867:133w    0       0       0       0       0       0       0       0      \n",
       "OTU5677:133w    0       0       0       0       0       0       0       0      \n",
       "OTU5575:133w    0       0       0       0       0       0       0       0      \n",
       "OTU4445:133w    0       0       0       0       0       0       0       0      \n",
       "OTU6203:133w    0       0       0       0       0       0       0       0      \n",
       "OTU7934:133w    0       0       0       0       0       0       0       0      \n",
       "OTU7163:133w    0       0       0       0       0       0       0       0      \n",
       "OTU12203:133w   0       0       0       0       0       0       0       0      \n",
       "OTU12502:PosG   0       0       0       0       0       0       0       0      \n",
       "OTU12503:PosG   0       0       0       0       0       0       0       0      \n",
       "                108leaf 109leaf ⋯ 124w 125w 128w 129w 130w 131w 133w Neg PosG\n",
       "OTU19:100leaf     0        0    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU108:100leaf    0        0    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU1:100leaf    859      504    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU202:100leaf    0        0    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU426:100leaf    0        0    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU1905:100leaf   0        0    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU10:100leaf     1       81    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU10433:17leaf   0        0    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU17:100leaf    51        2    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU429:100leaf    0        0    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU15:100leaf   220      557    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU27:100leaf   354       53    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU355:100leaf   18        9    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU8266:104leaf   0        0    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU22:101leaf     0        0    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU91:100leaf     0        0    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU570:100leaf    0        0    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU406:100leaf    0      332    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU181:100leaf    0     1962    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU520:100leaf    0       75    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU73:100leaf   325        0    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU159:100leaf  174       67    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU794:16leaf     0        0    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU297:100leaf    0       66    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU252:117leaf    0      186    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU1199:41leaf    0        0    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU951:14leaf     0        0    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU3434:50leaf    0        0    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU412:102leaf    0        0    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "OTU78:100leaf     0     2831    ⋯ 0    0    0    0    0    0    0    0   0   \n",
       "⋮               ⋮       ⋮       ⋱ ⋮    ⋮    ⋮    ⋮    ⋮    ⋮    ⋮    ⋮   ⋮   \n",
       "OTU6747:131w    0       0       ⋯ 0    0    0    0    0    20     0  0   0   \n",
       "OTU6000:131w    0       0       ⋯ 0    0    0    0    0    32     0  0   0   \n",
       "OTU6968:131w    0       0       ⋯ 0    0    0    0    0    16     0  0   0   \n",
       "OTU9675:131w    0       0       ⋯ 0    0    0    0    0    33     0  0   0   \n",
       "OTU6715:131w    0       0       ⋯ 0    0    0    0    0    19     0  0   0   \n",
       "OTU6054:131w    0       0       ⋯ 0    0    0    0    0    29     0  0   0   \n",
       "OTU12242:131w   0       0       ⋯ 0    0    0    0    0     2     0  0   0   \n",
       "OTU1516:133w    0       0       ⋯ 0    0    0    0    0     0   584  0   1   \n",
       "OTU1866:133w    0       0       ⋯ 0    0    0    0    0     0   498  0   1   \n",
       "OTU3982:133w    0       0       ⋯ 0    0    0    0    0     0    75  0   0   \n",
       "OTU5749:133w    0       0       ⋯ 0    0    0    0    0     0    34  0   0   \n",
       "OTU5806:133w    0       0       ⋯ 0    0    0    0    0     0    36  0   0   \n",
       "OTU4262:133w    0       0       ⋯ 0    0    0    0    0     0    70  0   0   \n",
       "OTU6274:133w    0       0       ⋯ 0    0    0    0    0     0    26  0   0   \n",
       "OTU4545:133w    0       0       ⋯ 0    0    0    0    0     0    52  0   0   \n",
       "OTU6207:133w    0       0       ⋯ 0    0    0    0    0     0    27  0   0   \n",
       "OTU5571:133w    0       0       ⋯ 0    0    0    0    0     0    34  0   0   \n",
       "OTU5846:133w    0       0       ⋯ 0    0    0    0    0     0    30  0   0   \n",
       "OTU7547:133w    0       0       ⋯ 0    0    0    0    0     0    20  0   0   \n",
       "OTU8051:133w    0       0       ⋯ 0    0    0    0    0     0    13  0   0   \n",
       "OTU5867:133w    0       0       ⋯ 0    0    0    0    0     0    34  0   0   \n",
       "OTU5677:133w    0       0       ⋯ 0    0    0    0    0     0    42  0   0   \n",
       "OTU5575:133w    0       0       ⋯ 0    0    0    0    0     0    31  0   0   \n",
       "OTU4445:133w    0       0       ⋯ 0    0    0    0    0     0    56  0   0   \n",
       "OTU6203:133w    0       0       ⋯ 0    0    0    0    0     0    26  0   0   \n",
       "OTU7934:133w    0       0       ⋯ 0    0    0    0    0     0    20  0   0   \n",
       "OTU7163:133w    0       0       ⋯ 0    0    0    0    0     0    18  0   0   \n",
       "OTU12203:133w   0       0       ⋯ 0    0    0    0    0     0     2  0   0   \n",
       "OTU12502:PosG   0       0       ⋯ 0    0    0    0    0     0     0  0   2   \n",
       "OTU12503:PosG   0       0       ⋯ 0    0    0    0    0     0     0  0   1   \n",
       "                PosI\n",
       "OTU19:100leaf   0   \n",
       "OTU108:100leaf  0   \n",
       "OTU1:100leaf    0   \n",
       "OTU202:100leaf  0   \n",
       "OTU426:100leaf  0   \n",
       "OTU1905:100leaf 0   \n",
       "OTU10:100leaf   0   \n",
       "OTU10433:17leaf 0   \n",
       "OTU17:100leaf   0   \n",
       "OTU429:100leaf  0   \n",
       "OTU15:100leaf   0   \n",
       "OTU27:100leaf   0   \n",
       "OTU355:100leaf  0   \n",
       "OTU8266:104leaf 0   \n",
       "OTU22:101leaf   0   \n",
       "OTU91:100leaf   0   \n",
       "OTU570:100leaf  0   \n",
       "OTU406:100leaf  0   \n",
       "OTU181:100leaf  0   \n",
       "OTU520:100leaf  0   \n",
       "OTU73:100leaf   0   \n",
       "OTU159:100leaf  0   \n",
       "OTU794:16leaf   0   \n",
       "OTU297:100leaf  0   \n",
       "OTU252:117leaf  0   \n",
       "OTU1199:41leaf  0   \n",
       "OTU951:14leaf   0   \n",
       "OTU3434:50leaf  0   \n",
       "OTU412:102leaf  0   \n",
       "OTU78:100leaf   0   \n",
       "⋮               ⋮   \n",
       "OTU6747:131w    0   \n",
       "OTU6000:131w    0   \n",
       "OTU6968:131w    0   \n",
       "OTU9675:131w    0   \n",
       "OTU6715:131w    0   \n",
       "OTU6054:131w    0   \n",
       "OTU12242:131w   0   \n",
       "OTU1516:133w    0   \n",
       "OTU1866:133w    0   \n",
       "OTU3982:133w    0   \n",
       "OTU5749:133w    0   \n",
       "OTU5806:133w    0   \n",
       "OTU4262:133w    0   \n",
       "OTU6274:133w    0   \n",
       "OTU4545:133w    0   \n",
       "OTU6207:133w    0   \n",
       "OTU5571:133w    0   \n",
       "OTU5846:133w    0   \n",
       "OTU7547:133w    0   \n",
       "OTU8051:133w    0   \n",
       "OTU5867:133w    0   \n",
       "OTU5677:133w    0   \n",
       "OTU5575:133w    0   \n",
       "OTU4445:133w    0   \n",
       "OTU6203:133w    0   \n",
       "OTU7934:133w    0   \n",
       "OTU7163:133w    0   \n",
       "OTU12203:133w   0   \n",
       "OTU12502:PosG   0   \n",
       "OTU12503:PosG   1   "
      ]
     },
     "metadata": {},
     "output_type": "display_data"
    }
   ],
   "source": [
    "otu_table(biom95_meta)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Seems okay. We'll work on the revised stats pipeline in a separate notebook."
   ]
  }
 ],
 "metadata": {
  "kernelspec": {
   "display_name": "R",
   "language": "R",
   "name": "ir"
  },
  "language_info": {
   "codemirror_mode": "r",
   "file_extension": ".r",
   "mimetype": "text/x-r-source",
   "name": "R",
   "pygments_lexer": "r",
   "version": "3.4.4"
  }
 },
 "nbformat": 4,
 "nbformat_minor": 1
}