Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

DNA splint sequence #3

Closed
callumparr opened this issue Sep 21, 2018 · 1 comment
Closed

DNA splint sequence #3

callumparr opened this issue Sep 21, 2018 · 1 comment

Comments

@callumparr
Copy link

I wanted to try out this script using the SRA archived SIRV data but I cannot see a DNA splint sequence supplied. I think I worked out the sequence from find the fwd and rev primer sequences in a downloaded lambda DNA fasta file. But I am unsure whether this is the exact lambda DNA sequence you used or not

Sequence is included the:

TGAGGCTGATGAGTTCCATATTTGAAAAGTTTTCATCACTACTTAGTTTTTTGATAGCTTCAAGCCAGAGTTGTCTTTTTCTATCTACTCTCATACAACCAATAAATGCTGAAATGAATTCTAAGCGGAGATCGCCTAGTGATTTTAAACTATTGCTGGCAGCATTCTTGAGTCCAATATAAAAGTATTGTGTACCTTTTGCTGGGTCAGGTTGTTCTTTAGGAGGAGTAAAAGGATCAAATGCACTAAACGAAACTGAAACAAGCGATCGAAAATATCCCTTT

@rvolden
Copy link
Owner

rvolden commented Sep 21, 2018

Yeah that looks fine to me

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Labels
None yet
Projects
None yet
Development

No branches or pull requests

2 participants