Gastropoda Transcriptome Assembly Pipeline.html

<!DOCTYPE html>
<html>
<head><meta charset="utf-8" />

<title>Gastropoda Transcriptome Assembly Pipeline</title>

<script src="https://cdnjs.cloudflare.com/ajax/libs/require.js/2.1.10/require.min.js"></script>
<script src="https://cdnjs.cloudflare.com/ajax/libs/jquery/2.0.3/jquery.min.js"></script>


<style type="text/css">
    /*!
*
* Twitter Bootstrap
*
*/
/*!
 * Bootstrap v3.3.7 (http://getbootstrap.com)
 * Copyright 2011-2016 Twitter, Inc.
 * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
 */
/*! normalize.css v3.0.3 | MIT License | github.com/necolas/normalize.css */
html {
  font-family: sans-serif;
  -ms-text-size-adjust: 100%;
  -webkit-text-size-adjust: 100%;
}
body {
  margin: 0;
}
article,
aside,
details,
figcaption,
figure,
footer,
header,
hgroup,
main,
menu,
nav,
section,
summary {
  display: block;
}
audio,
canvas,
progress,
video {
  display: inline-block;
  vertical-align: baseline;
}
audio:not([controls]) {
  display: none;
  height: 0;
}
[hidden],
template {
  display: none;
}
a {
  background-color: transparent;
}
a:active,
a:hover {
  outline: 0;
}
abbr[title] {
  border-bottom: 1px dotted;
}
b,
strong {
  font-weight: bold;
}
dfn {
  font-style: italic;
}
h1 {
  font-size: 2em;
  margin: 0.67em 0;
}
mark {
  background: #ff0;
  color: #000;
}
small {
  font-size: 80%;
}
sub,
sup {
  font-size: 75%;
  line-height: 0;
  position: relative;
  vertical-align: baseline;
}
sup {
  top: -0.5em;
}
sub {
  bottom: -0.25em;
}
img {
  border: 0;
}
svg:not(:root) {
  overflow: hidden;
}
figure {
  margin: 1em 40px;
}
hr {
  box-sizing: content-box;
  height: 0;
}
pre {
  overflow: auto;
}
code,
kbd,
pre,
samp {
  font-family: monospace, monospace;
  font-size: 1em;
}
button,
input,
optgroup,
select,
textarea {
  color: inherit;
  font: inherit;
  margin: 0;
}
button {
  overflow: visible;
}
button,
select {
  text-transform: none;
}
button,
html input[type="button"],
input[type="reset"],
input[type="submit"] {
  -webkit-appearance: button;
  cursor: pointer;
}
button[disabled],
html input[disabled] {
  cursor: default;
}
button::-moz-focus-inner,
input::-moz-focus-inner {
  border: 0;
  padding: 0;
}
input {
  line-height: normal;
}
input[type="checkbox"],
input[type="radio"] {
  box-sizing: border-box;
  padding: 0;
}
input[type="number"]::-webkit-inner-spin-button,
input[type="number"]::-webkit-outer-spin-button {
  height: auto;
}
input[type="search"] {
  -webkit-appearance: textfield;
  box-sizing: content-box;
}
input[type="search"]::-webkit-search-cancel-button,
input[type="search"]::-webkit-search-decoration {
  -webkit-appearance: none;
}
fieldset {
  border: 1px solid #c0c0c0;
  margin: 0 2px;
  padding: 0.35em 0.625em 0.75em;
}
legend {
  border: 0;
  padding: 0;
}
textarea {
  overflow: auto;
}
optgroup {
  font-weight: bold;
}
table {
  border-collapse: collapse;
  border-spacing: 0;
}
td,
th {
  padding: 0;
}
/*! Source: https://github.com/h5bp/html5-boilerplate/blob/master/src/css/main.css */
@media print {
  *,
  *:before,
  *:after {
    background: transparent !important;
    box-shadow: none !important;
    text-shadow: none !important;
  }
  a,
  a:visited {
    text-decoration: underline;
  }
  a[href]:after {
    content: " (" attr(href) ")";
  }
  abbr[title]:after {
    content: " (" attr(title) ")";
  }
  a[href^="#"]:after,
  a[href^="javascript:"]:after {
    content: "";
  }
  pre,
  blockquote {
    border: 1px solid #999;
    page-break-inside: avoid;
  }
  thead {
    display: table-header-group;
  }
  tr,
  img {
    page-break-inside: avoid;
  }
  img {
    max-width: 100% !important;
  }
  p,
  h2,
  h3 {
    orphans: 3;
    widows: 3;
  }
  h2,
  h3 {
    page-break-after: avoid;
  }
  .navbar {
    display: none;
  }
  .btn > .caret,
  .dropup > .btn > .caret {
    border-top-color: #000 !important;
  }
  .label {
    border: 1px solid #000;
  }
  .table {
    border-collapse: collapse !important;
  }
  .table td,
  .table th {
    background-color: #fff !important;
  }
  .table-bordered th,
  .table-bordered td {
    border: 1px solid #ddd !important;
  }
}
@font-face {
  font-family: 'Glyphicons Halflings';
  src: url('../components/bootstrap/fonts/glyphicons-halflings-regular.eot');
  src: url('../components/bootstrap/fonts/glyphicons-halflings-regular.eot?#iefix') format('embedded-opentype'), url('../components/bootstrap/fonts/glyphicons-halflings-regular.woff2') format('woff2'), url('../components/bootstrap/fonts/glyphicons-halflings-regular.woff') format('woff'), url('../components/bootstrap/fonts/glyphicons-halflings-regular.ttf') format('truetype'), url('../components/bootstrap/fonts/glyphicons-halflings-regular.svg#glyphicons_halflingsregular') format('svg');
}
.glyphicon {
  position: relative;
  top: 1px;
  display: inline-block;
  font-family: 'Glyphicons Halflings';
  font-style: normal;
  font-weight: normal;
  line-height: 1;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
}
.glyphicon-asterisk:before {
  content: "\002a";
}
.glyphicon-plus:before {
  content: "\002b";
}
.glyphicon-euro:before,
.glyphicon-eur:before {
  content: "\20ac";
}
.glyphicon-minus:before {
  content: "\2212";
}
.glyphicon-cloud:before {
  content: "\2601";
}
.glyphicon-envelope:before {
  content: "\2709";
}
.glyphicon-pencil:before {
  content: "\270f";
}
.glyphicon-glass:before {
  content: "\e001";
}
.glyphicon-music:before {
  content: "\e002";
}
.glyphicon-search:before {
  content: "\e003";
}
.glyphicon-heart:before {
  content: "\e005";
}
.glyphicon-star:before {
  content: "\e006";
}
.glyphicon-star-empty:before {
  content: "\e007";
}
.glyphicon-user:before {
  content: "\e008";
}
.glyphicon-film:before {
  content: "\e009";
}
.glyphicon-th-large:before {
  content: "\e010";
}
.glyphicon-th:before {
  content: "\e011";
}
.glyphicon-th-list:before {
  content: "\e012";
}
.glyphicon-ok:before {
  content: "\e013";
}
.glyphicon-remove:before {
  content: "\e014";
}
.glyphicon-zoom-in:before {
  content: "\e015";
}
.glyphicon-zoom-out:before {
  content: "\e016";
}
.glyphicon-off:before {
  content: "\e017";
}
.glyphicon-signal:before {
  content: "\e018";
}
.glyphicon-cog:before {
  content: "\e019";
}
.glyphicon-trash:before {
  content: "\e020";
}
.glyphicon-home:before {
  content: "\e021";
}
.glyphicon-file:before {
  content: "\e022";
}
.glyphicon-time:before {
  content: "\e023";
}
.glyphicon-road:before {
  content: "\e024";
}
.glyphicon-download-alt:before {
  content: "\e025";
}
.glyphicon-download:before {
  content: "\e026";
}
.glyphicon-upload:before {
  content: "\e027";
}
.glyphicon-inbox:before {
  content: "\e028";
}
.glyphicon-play-circle:before {
  content: "\e029";
}
.glyphicon-repeat:before {
  content: "\e030";
}
.glyphicon-refresh:before {
  content: "\e031";
}
.glyphicon-list-alt:before {
  content: "\e032";
}
.glyphicon-lock:before {
  content: "\e033";
}
.glyphicon-flag:before {
  content: "\e034";
}
.glyphicon-headphones:before {
  content: "\e035";
}
.glyphicon-volume-off:before {
  content: "\e036";
}
.glyphicon-volume-down:before {
  content: "\e037";
}
.glyphicon-volume-up:before {
  content: "\e038";
}
.glyphicon-qrcode:before {
  content: "\e039";
}
.glyphicon-barcode:before {
  content: "\e040";
}
.glyphicon-tag:before {
  content: "\e041";
}
.glyphicon-tags:before {
  content: "\e042";
}
.glyphicon-book:before {
  content: "\e043";
}
.glyphicon-bookmark:before {
  content: "\e044";
}
.glyphicon-print:before {
  content: "\e045";
}
.glyphicon-camera:before {
  content: "\e046";
}
.glyphicon-font:before {
  content: "\e047";
}
.glyphicon-bold:before {
  content: "\e048";
}
.glyphicon-italic:before {
  content: "\e049";
}
.glyphicon-text-height:before {
  content: "\e050";
}
.glyphicon-text-width:before {
  content: "\e051";
}
.glyphicon-align-left:before {
  content: "\e052";
}
.glyphicon-align-center:before {
  content: "\e053";
}
.glyphicon-align-right:before {
  content: "\e054";
}
.glyphicon-align-justify:before {
  content: "\e055";
}
.glyphicon-list:before {
  content: "\e056";
}
.glyphicon-indent-left:before {
  content: "\e057";
}
.glyphicon-indent-right:before {
  content: "\e058";
}
.glyphicon-facetime-video:before {
  content: "\e059";
}
.glyphicon-picture:before {
  content: "\e060";
}
.glyphicon-map-marker:before {
  content: "\e062";
}
.glyphicon-adjust:before {
  content: "\e063";
}
.glyphicon-tint:before {
  content: "\e064";
}
.glyphicon-edit:before {
  content: "\e065";
}
.glyphicon-share:before {
  content: "\e066";
}
.glyphicon-check:before {
  content: "\e067";
}
.glyphicon-move:before {
  content: "\e068";
}
.glyphicon-step-backward:before {
  content: "\e069";
}
.glyphicon-fast-backward:before {
  content: "\e070";
}
.glyphicon-backward:before {
  content: "\e071";
}
.glyphicon-play:before {
  content: "\e072";
}
.glyphicon-pause:before {
  content: "\e073";
}
.glyphicon-stop:before {
  content: "\e074";
}
.glyphicon-forward:before {
  content: "\e075";
}
.glyphicon-fast-forward:before {
  content: "\e076";
}
.glyphicon-step-forward:before {
  content: "\e077";
}
.glyphicon-eject:before {
  content: "\e078";
}
.glyphicon-chevron-left:before {
  content: "\e079";
}
.glyphicon-chevron-right:before {
  content: "\e080";
}
.glyphicon-plus-sign:before {
  content: "\e081";
}
.glyphicon-minus-sign:before {
  content: "\e082";
}
.glyphicon-remove-sign:before {
  content: "\e083";
}
.glyphicon-ok-sign:before {
  content: "\e084";
}
.glyphicon-question-sign:before {
  content: "\e085";
}
.glyphicon-info-sign:before {
  content: "\e086";
}
.glyphicon-screenshot:before {
  content: "\e087";
}
.glyphicon-remove-circle:before {
  content: "\e088";
}
.glyphicon-ok-circle:before {
  content: "\e089";
}
.glyphicon-ban-circle:before {
  content: "\e090";
}
.glyphicon-arrow-left:before {
  content: "\e091";
}
.glyphicon-arrow-right:before {
  content: "\e092";
}
.glyphicon-arrow-up:before {
  content: "\e093";
}
.glyphicon-arrow-down:before {
  content: "\e094";
}
.glyphicon-share-alt:before {
  content: "\e095";
}
.glyphicon-resize-full:before {
  content: "\e096";
}
.glyphicon-resize-small:before {
  content: "\e097";
}
.glyphicon-exclamation-sign:before {
  content: "\e101";
}
.glyphicon-gift:before {
  content: "\e102";
}
.glyphicon-leaf:before {
  content: "\e103";
}
.glyphicon-fire:before {
  content: "\e104";
}
.glyphicon-eye-open:before {
  content: "\e105";
}
.glyphicon-eye-close:before {
  content: "\e106";
}
.glyphicon-warning-sign:before {
  content: "\e107";
}
.glyphicon-plane:before {
  content: "\e108";
}
.glyphicon-calendar:before {
  content: "\e109";
}
.glyphicon-random:before {
  content: "\e110";
}
.glyphicon-comment:before {
  content: "\e111";
}
.glyphicon-magnet:before {
  content: "\e112";
}
.glyphicon-chevron-up:before {
  content: "\e113";
}
.glyphicon-chevron-down:before {
  content: "\e114";
}
.glyphicon-retweet:before {
  content: "\e115";
}
.glyphicon-shopping-cart:before {
  content: "\e116";
}
.glyphicon-folder-close:before {
  content: "\e117";
}
.glyphicon-folder-open:before {
  content: "\e118";
}
.glyphicon-resize-vertical:before {
  content: "\e119";
}
.glyphicon-resize-horizontal:before {
  content: "\e120";
}
.glyphicon-hdd:before {
  content: "\e121";
}
.glyphicon-bullhorn:before {
  content: "\e122";
}
.glyphicon-bell:before {
  content: "\e123";
}
.glyphicon-certificate:before {
  content: "\e124";
}
.glyphicon-thumbs-up:before {
  content: "\e125";
}
.glyphicon-thumbs-down:before {
  content: "\e126";
}
.glyphicon-hand-right:before {
  content: "\e127";
}
.glyphicon-hand-left:before {
  content: "\e128";
}
.glyphicon-hand-up:before {
  content: "\e129";
}
.glyphicon-hand-down:before {
  content: "\e130";
}
.glyphicon-circle-arrow-right:before {
  content: "\e131";
}
.glyphicon-circle-arrow-left:before {
  content: "\e132";
}
.glyphicon-circle-arrow-up:before {
  content: "\e133";
}
.glyphicon-circle-arrow-down:before {
  content: "\e134";
}
.glyphicon-globe:before {
  content: "\e135";
}
.glyphicon-wrench:before {
  content: "\e136";
}
.glyphicon-tasks:before {
  content: "\e137";
}
.glyphicon-filter:before {
  content: "\e138";
}
.glyphicon-briefcase:before {
  content: "\e139";
}
.glyphicon-fullscreen:before {
  content: "\e140";
}
.glyphicon-dashboard:before {
  content: "\e141";
}
.glyphicon-paperclip:before {
  content: "\e142";
}
.glyphicon-heart-empty:before {
  content: "\e143";
}
.glyphicon-link:before {
  content: "\e144";
}
.glyphicon-phone:before {
  content: "\e145";
}
.glyphicon-pushpin:before {
  content: "\e146";
}
.glyphicon-usd:before {
  content: "\e148";
}
.glyphicon-gbp:before {
  content: "\e149";
}
.glyphicon-sort:before {
  content: "\e150";
}
.glyphicon-sort-by-alphabet:before {
  content: "\e151";
}
.glyphicon-sort-by-alphabet-alt:before {
  content: "\e152";
}
.glyphicon-sort-by-order:before {
  content: "\e153";
}
.glyphicon-sort-by-order-alt:before {
  content: "\e154";
}
.glyphicon-sort-by-attributes:before {
  content: "\e155";
}
.glyphicon-sort-by-attributes-alt:before {
  content: "\e156";
}
.glyphicon-unchecked:before {
  content: "\e157";
}
.glyphicon-expand:before {
  content: "\e158";
}
.glyphicon-collapse-down:before {
  content: "\e159";
}
.glyphicon-collapse-up:before {
  content: "\e160";
}
.glyphicon-log-in:before {
  content: "\e161";
}
.glyphicon-flash:before {
  content: "\e162";
}
.glyphicon-log-out:before {
  content: "\e163";
}
.glyphicon-new-window:before {
  content: "\e164";
}
.glyphicon-record:before {
  content: "\e165";
}
.glyphicon-save:before {
  content: "\e166";
}
.glyphicon-open:before {
  content: "\e167";
}
.glyphicon-saved:before {
  content: "\e168";
}
.glyphicon-import:before {
  content: "\e169";
}
.glyphicon-export:before {
  content: "\e170";
}
.glyphicon-send:before {
  content: "\e171";
}
.glyphicon-floppy-disk:before {
  content: "\e172";
}
.glyphicon-floppy-saved:before {
  content: "\e173";
}
.glyphicon-floppy-remove:before {
  content: "\e174";
}
.glyphicon-floppy-save:before {
  content: "\e175";
}
.glyphicon-floppy-open:before {
  content: "\e176";
}
.glyphicon-credit-card:before {
  content: "\e177";
}
.glyphicon-transfer:before {
  content: "\e178";
}
.glyphicon-cutlery:before {
  content: "\e179";
}
.glyphicon-header:before {
  content: "\e180";
}
.glyphicon-compressed:before {
  content: "\e181";
}
.glyphicon-earphone:before {
  content: "\e182";
}
.glyphicon-phone-alt:before {
  content: "\e183";
}
.glyphicon-tower:before {
  content: "\e184";
}
.glyphicon-stats:before {
  content: "\e185";
}
.glyphicon-sd-video:before {
  content: "\e186";
}
.glyphicon-hd-video:before {
  content: "\e187";
}
.glyphicon-subtitles:before {
  content: "\e188";
}
.glyphicon-sound-stereo:before {
  content: "\e189";
}
.glyphicon-sound-dolby:before {
  content: "\e190";
}
.glyphicon-sound-5-1:before {
  content: "\e191";
}
.glyphicon-sound-6-1:before {
  content: "\e192";
}
.glyphicon-sound-7-1:before {
  content: "\e193";
}
.glyphicon-copyright-mark:before {
  content: "\e194";
}
.glyphicon-registration-mark:before {
  content: "\e195";
}
.glyphicon-cloud-download:before {
  content: "\e197";
}
.glyphicon-cloud-upload:before {
  content: "\e198";
}
.glyphicon-tree-conifer:before {
  content: "\e199";
}
.glyphicon-tree-deciduous:before {
  content: "\e200";
}
.glyphicon-cd:before {
  content: "\e201";
}
.glyphicon-save-file:before {
  content: "\e202";
}
.glyphicon-open-file:before {
  content: "\e203";
}
.glyphicon-level-up:before {
  content: "\e204";
}
.glyphicon-copy:before {
  content: "\e205";
}
.glyphicon-paste:before {
  content: "\e206";
}
.glyphicon-alert:before {
  content: "\e209";
}
.glyphicon-equalizer:before {
  content: "\e210";
}
.glyphicon-king:before {
  content: "\e211";
}
.glyphicon-queen:before {
  content: "\e212";
}
.glyphicon-pawn:before {
  content: "\e213";
}
.glyphicon-bishop:before {
  content: "\e214";
}
.glyphicon-knight:before {
  content: "\e215";
}
.glyphicon-baby-formula:before {
  content: "\e216";
}
.glyphicon-tent:before {
  content: "\26fa";
}
.glyphicon-blackboard:before {
  content: "\e218";
}
.glyphicon-bed:before {
  content: "\e219";
}
.glyphicon-apple:before {
  content: "\f8ff";
}
.glyphicon-erase:before {
  content: "\e221";
}
.glyphicon-hourglass:before {
  content: "\231b";
}
.glyphicon-lamp:before {
  content: "\e223";
}
.glyphicon-duplicate:before {
  content: "\e224";
}
.glyphicon-piggy-bank:before {
  content: "\e225";
}
.glyphicon-scissors:before {
  content: "\e226";
}
.glyphicon-bitcoin:before {
  content: "\e227";
}
.glyphicon-btc:before {
  content: "\e227";
}
.glyphicon-xbt:before {
  content: "\e227";
}
.glyphicon-yen:before {
  content: "\00a5";
}
.glyphicon-jpy:before {
  content: "\00a5";
}
.glyphicon-ruble:before {
  content: "\20bd";
}
.glyphicon-rub:before {
  content: "\20bd";
}
.glyphicon-scale:before {
  content: "\e230";
}
.glyphicon-ice-lolly:before {
  content: "\e231";
}
.glyphicon-ice-lolly-tasted:before {
  content: "\e232";
}
.glyphicon-education:before {
  content: "\e233";
}
.glyphicon-option-horizontal:before {
  content: "\e234";
}
.glyphicon-option-vertical:before {
  content: "\e235";
}
.glyphicon-menu-hamburger:before {
  content: "\e236";
}
.glyphicon-modal-window:before {
  content: "\e237";
}
.glyphicon-oil:before {
  content: "\e238";
}
.glyphicon-grain:before {
  content: "\e239";
}
.glyphicon-sunglasses:before {
  content: "\e240";
}
.glyphicon-text-size:before {
  content: "\e241";
}
.glyphicon-text-color:before {
  content: "\e242";
}
.glyphicon-text-background:before {
  content: "\e243";
}
.glyphicon-object-align-top:before {
  content: "\e244";
}
.glyphicon-object-align-bottom:before {
  content: "\e245";
}
.glyphicon-object-align-horizontal:before {
  content: "\e246";
}
.glyphicon-object-align-left:before {
  content: "\e247";
}
.glyphicon-object-align-vertical:before {
  content: "\e248";
}
.glyphicon-object-align-right:before {
  content: "\e249";
}
.glyphicon-triangle-right:before {
  content: "\e250";
}
.glyphicon-triangle-left:before {
  content: "\e251";
}
.glyphicon-triangle-bottom:before {
  content: "\e252";
}
.glyphicon-triangle-top:before {
  content: "\e253";
}
.glyphicon-console:before {
  content: "\e254";
}
.glyphicon-superscript:before {
  content: "\e255";
}
.glyphicon-subscript:before {
  content: "\e256";
}
.glyphicon-menu-left:before {
  content: "\e257";
}
.glyphicon-menu-right:before {
  content: "\e258";
}
.glyphicon-menu-down:before {
  content: "\e259";
}
.glyphicon-menu-up:before {
  content: "\e260";
}
* {
  -webkit-box-sizing: border-box;
  -moz-box-sizing: border-box;
  box-sizing: border-box;
}
*:before,
*:after {
  -webkit-box-sizing: border-box;
  -moz-box-sizing: border-box;
  box-sizing: border-box;
}
html {
  font-size: 10px;
  -webkit-tap-highlight-color: rgba(0, 0, 0, 0);
}
body {
  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
  font-size: 13px;
  line-height: 1.42857143;
  color: #000;
  background-color: #fff;
}
input,
button,
select,
textarea {
  font-family: inherit;
  font-size: inherit;
  line-height: inherit;
}
a {
  color: #337ab7;
  text-decoration: none;
}
a:hover,
a:focus {
  color: #23527c;
  text-decoration: underline;
}
a:focus {
  outline: 5px auto -webkit-focus-ring-color;
  outline-offset: -2px;
}
figure {
  margin: 0;
}
img {
  vertical-align: middle;
}
.img-responsive,
.thumbnail > img,
.thumbnail a > img,
.carousel-inner > .item > img,
.carousel-inner > .item > a > img {
  display: block;
  max-width: 100%;
  height: auto;
}
.img-rounded {
  border-radius: 3px;
}
.img-thumbnail {
  padding: 4px;
  line-height: 1.42857143;
  background-color: #fff;
  border: 1px solid #ddd;
  border-radius: 2px;
  -webkit-transition: all 0.2s ease-in-out;
  -o-transition: all 0.2s ease-in-out;
  transition: all 0.2s ease-in-out;
  display: inline-block;
  max-width: 100%;
  height: auto;
}
.img-circle {
  border-radius: 50%;
}
hr {
  margin-top: 18px;
  margin-bottom: 18px;
  border: 0;
  border-top: 1px solid #eeeeee;
}
.sr-only {
  position: absolute;
  width: 1px;
  height: 1px;
  margin: -1px;
  padding: 0;
  overflow: hidden;
  clip: rect(0, 0, 0, 0);
  border: 0;
}
.sr-only-focusable:active,
.sr-only-focusable:focus {
  position: static;
  width: auto;
  height: auto;
  margin: 0;
  overflow: visible;
  clip: auto;
}
[role="button"] {
  cursor: pointer;
}
h1,
h2,
h3,
h4,
h5,
h6,
.h1,
.h2,
.h3,
.h4,
.h5,
.h6 {
  font-family: inherit;
  font-weight: 500;
  line-height: 1.1;
  color: inherit;
}
h1 small,
h2 small,
h3 small,
h4 small,
h5 small,
h6 small,
.h1 small,
.h2 small,
.h3 small,
.h4 small,
.h5 small,
.h6 small,
h1 .small,
h2 .small,
h3 .small,
h4 .small,
h5 .small,
h6 .small,
.h1 .small,
.h2 .small,
.h3 .small,
.h4 .small,
.h5 .small,
.h6 .small {
  font-weight: normal;
  line-height: 1;
  color: #777777;
}
h1,
.h1,
h2,
.h2,
h3,
.h3 {
  margin-top: 18px;
  margin-bottom: 9px;
}
h1 small,
.h1 small,
h2 small,
.h2 small,
h3 small,
.h3 small,
h1 .small,
.h1 .small,
h2 .small,
.h2 .small,
h3 .small,
.h3 .small {
  font-size: 65%;
}
h4,
.h4,
h5,
.h5,
h6,
.h6 {
  margin-top: 9px;
  margin-bottom: 9px;
}
h4 small,
.h4 small,
h5 small,
.h5 small,
h6 small,
.h6 small,
h4 .small,
.h4 .small,
h5 .small,
.h5 .small,
h6 .small,
.h6 .small {
  font-size: 75%;
}
h1,
.h1 {
  font-size: 33px;
}
h2,
.h2 {
  font-size: 27px;
}
h3,
.h3 {
  font-size: 23px;
}
h4,
.h4 {
  font-size: 17px;
}
h5,
.h5 {
  font-size: 13px;
}
h6,
.h6 {
  font-size: 12px;
}
p {
  margin: 0 0 9px;
}
.lead {
  margin-bottom: 18px;
  font-size: 14px;
  font-weight: 300;
  line-height: 1.4;
}
@media (min-width: 768px) {
  .lead {
    font-size: 19.5px;
  }
}
small,
.small {
  font-size: 92%;
}
mark,
.mark {
  background-color: #fcf8e3;
  padding: .2em;
}
.text-left {
  text-align: left;
}
.text-right {
  text-align: right;
}
.text-center {
  text-align: center;
}
.text-justify {
  text-align: justify;
}
.text-nowrap {
  white-space: nowrap;
}
.text-lowercase {
  text-transform: lowercase;
}
.text-uppercase {
  text-transform: uppercase;
}
.text-capitalize {
  text-transform: capitalize;
}
.text-muted {
  color: #777777;
}
.text-primary {
  color: #337ab7;
}
a.text-primary:hover,
a.text-primary:focus {
  color: #286090;
}
.text-success {
  color: #3c763d;
}
a.text-success:hover,
a.text-success:focus {
  color: #2b542c;
}
.text-info {
  color: #31708f;
}
a.text-info:hover,
a.text-info:focus {
  color: #245269;
}
.text-warning {
  color: #8a6d3b;
}
a.text-warning:hover,
a.text-warning:focus {
  color: #66512c;
}
.text-danger {
  color: #a94442;
}
a.text-danger:hover,
a.text-danger:focus {
  color: #843534;
}
.bg-primary {
  color: #fff;
  background-color: #337ab7;
}
a.bg-primary:hover,
a.bg-primary:focus {
  background-color: #286090;
}
.bg-success {
  background-color: #dff0d8;
}
a.bg-success:hover,
a.bg-success:focus {
  background-color: #c1e2b3;
}
.bg-info {
  background-color: #d9edf7;
}
a.bg-info:hover,
a.bg-info:focus {
  background-color: #afd9ee;
}
.bg-warning {
  background-color: #fcf8e3;
}
a.bg-warning:hover,
a.bg-warning:focus {
  background-color: #f7ecb5;
}
.bg-danger {
  background-color: #f2dede;
}
a.bg-danger:hover,
a.bg-danger:focus {
  background-color: #e4b9b9;
}
.page-header {
  padding-bottom: 8px;
  margin: 36px 0 18px;
  border-bottom: 1px solid #eeeeee;
}
ul,
ol {
  margin-top: 0;
  margin-bottom: 9px;
}
ul ul,
ol ul,
ul ol,
ol ol {
  margin-bottom: 0;
}
.list-unstyled {
  padding-left: 0;
  list-style: none;
}
.list-inline {
  padding-left: 0;
  list-style: none;
  margin-left: -5px;
}
.list-inline > li {
  display: inline-block;
  padding-left: 5px;
  padding-right: 5px;
}
dl {
  margin-top: 0;
  margin-bottom: 18px;
}
dt,
dd {
  line-height: 1.42857143;
}
dt {
  font-weight: bold;
}
dd {
  margin-left: 0;
}
@media (min-width: 541px) {
  .dl-horizontal dt {
    float: left;
    width: 160px;
    clear: left;
    text-align: right;
    overflow: hidden;
    text-overflow: ellipsis;
    white-space: nowrap;
  }
  .dl-horizontal dd {
    margin-left: 180px;
  }
}
abbr[title],
abbr[data-original-title] {
  cursor: help;
  border-bottom: 1px dotted #777777;
}
.initialism {
  font-size: 90%;
  text-transform: uppercase;
}
blockquote {
  padding: 9px 18px;
  margin: 0 0 18px;
  font-size: inherit;
  border-left: 5px solid #eeeeee;
}
blockquote p:last-child,
blockquote ul:last-child,
blockquote ol:last-child {
  margin-bottom: 0;
}
blockquote footer,
blockquote small,
blockquote .small {
  display: block;
  font-size: 80%;
  line-height: 1.42857143;
  color: #777777;
}
blockquote footer:before,
blockquote small:before,
blockquote .small:before {
  content: '\2014 \00A0';
}
.blockquote-reverse,
blockquote.pull-right {
  padding-right: 15px;
  padding-left: 0;
  border-right: 5px solid #eeeeee;
  border-left: 0;
  text-align: right;
}
.blockquote-reverse footer:before,
blockquote.pull-right footer:before,
.blockquote-reverse small:before,
blockquote.pull-right small:before,
.blockquote-reverse .small:before,
blockquote.pull-right .small:before {
  content: '';
}
.blockquote-reverse footer:after,
blockquote.pull-right footer:after,
.blockquote-reverse small:after,
blockquote.pull-right small:after,
.blockquote-reverse .small:after,
blockquote.pull-right .small:after {
  content: '\00A0 \2014';
}
address {
  margin-bottom: 18px;
  font-style: normal;
  line-height: 1.42857143;
}
code,
kbd,
pre,
samp {
  font-family: monospace;
}
code {
  padding: 2px 4px;
  font-size: 90%;
  color: #c7254e;
  background-color: #f9f2f4;
  border-radius: 2px;
}
kbd {
  padding: 2px 4px;
  font-size: 90%;
  color: #888;
  background-color: transparent;
  border-radius: 1px;
  box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.25);
}
kbd kbd {
  padding: 0;
  font-size: 100%;
  font-weight: bold;
  box-shadow: none;
}
pre {
  display: block;
  padding: 8.5px;
  margin: 0 0 9px;
  font-size: 12px;
  line-height: 1.42857143;
  word-break: break-all;
  word-wrap: break-word;
  color: #333333;
  background-color: #f5f5f5;
  border: 1px solid #ccc;
  border-radius: 2px;
}
pre code {
  padding: 0;
  font-size: inherit;
  color: inherit;
  white-space: pre-wrap;
  background-color: transparent;
  border-radius: 0;
}
.pre-scrollable {
  max-height: 340px;
  overflow-y: scroll;
}
.container {
  margin-right: auto;
  margin-left: auto;
  padding-left: 0px;
  padding-right: 0px;
}
@media (min-width: 768px) {
  .container {
    width: 768px;
  }
}
@media (min-width: 992px) {
  .container {
    width: 940px;
  }
}
@media (min-width: 1200px) {
  .container {
    width: 1140px;
  }
}
.container-fluid {
  margin-right: auto;
  margin-left: auto;
  padding-left: 0px;
  padding-right: 0px;
}
.row {
  margin-left: 0px;
  margin-right: 0px;
}
.col-xs-1, .col-sm-1, .col-md-1, .col-lg-1, .col-xs-2, .col-sm-2, .col-md-2, .col-lg-2, .col-xs-3, .col-sm-3, .col-md-3, .col-lg-3, .col-xs-4, .col-sm-4, .col-md-4, .col-lg-4, .col-xs-5, .col-sm-5, .col-md-5, .col-lg-5, .col-xs-6, .col-sm-6, .col-md-6, .col-lg-6, .col-xs-7, .col-sm-7, .col-md-7, .col-lg-7, .col-xs-8, .col-sm-8, .col-md-8, .col-lg-8, .col-xs-9, .col-sm-9, .col-md-9, .col-lg-9, .col-xs-10, .col-sm-10, .col-md-10, .col-lg-10, .col-xs-11, .col-sm-11, .col-md-11, .col-lg-11, .col-xs-12, .col-sm-12, .col-md-12, .col-lg-12 {
  position: relative;
  min-height: 1px;
  padding-left: 0px;
  padding-right: 0px;
}
.col-xs-1, .col-xs-2, .col-xs-3, .col-xs-4, .col-xs-5, .col-xs-6, .col-xs-7, .col-xs-8, .col-xs-9, .col-xs-10, .col-xs-11, .col-xs-12 {
  float: left;
}
.col-xs-12 {
  width: 100%;
}
.col-xs-11 {
  width: 91.66666667%;
}
.col-xs-10 {
  width: 83.33333333%;
}
.col-xs-9 {
  width: 75%;
}
.col-xs-8 {
  width: 66.66666667%;
}
.col-xs-7 {
  width: 58.33333333%;
}
.col-xs-6 {
  width: 50%;
}
.col-xs-5 {
  width: 41.66666667%;
}
.col-xs-4 {
  width: 33.33333333%;
}
.col-xs-3 {
  width: 25%;
}
.col-xs-2 {
  width: 16.66666667%;
}
.col-xs-1 {
  width: 8.33333333%;
}
.col-xs-pull-12 {
  right: 100%;
}
.col-xs-pull-11 {
  right: 91.66666667%;
}
.col-xs-pull-10 {
  right: 83.33333333%;
}
.col-xs-pull-9 {
  right: 75%;
}
.col-xs-pull-8 {
  right: 66.66666667%;
}
.col-xs-pull-7 {
  right: 58.33333333%;
}
.col-xs-pull-6 {
  right: 50%;
}
.col-xs-pull-5 {
  right: 41.66666667%;
}
.col-xs-pull-4 {
  right: 33.33333333%;
}
.col-xs-pull-3 {
  right: 25%;
}
.col-xs-pull-2 {
  right: 16.66666667%;
}
.col-xs-pull-1 {
  right: 8.33333333%;
}
.col-xs-pull-0 {
  right: auto;
}
.col-xs-push-12 {
  left: 100%;
}
.col-xs-push-11 {
  left: 91.66666667%;
}
.col-xs-push-10 {
  left: 83.33333333%;
}
.col-xs-push-9 {
  left: 75%;
}
.col-xs-push-8 {
  left: 66.66666667%;
}
.col-xs-push-7 {
  left: 58.33333333%;
}
.col-xs-push-6 {
  left: 50%;
}
.col-xs-push-5 {
  left: 41.66666667%;
}
.col-xs-push-4 {
  left: 33.33333333%;
}
.col-xs-push-3 {
  left: 25%;
}
.col-xs-push-2 {
  left: 16.66666667%;
}
.col-xs-push-1 {
  left: 8.33333333%;
}
.col-xs-push-0 {
  left: auto;
}
.col-xs-offset-12 {
  margin-left: 100%;
}
.col-xs-offset-11 {
  margin-left: 91.66666667%;
}
.col-xs-offset-10 {
  margin-left: 83.33333333%;
}
.col-xs-offset-9 {
  margin-left: 75%;
}
.col-xs-offset-8 {
  margin-left: 66.66666667%;
}
.col-xs-offset-7 {
  margin-left: 58.33333333%;
}
.col-xs-offset-6 {
  margin-left: 50%;
}
.col-xs-offset-5 {
  margin-left: 41.66666667%;
}
.col-xs-offset-4 {
  margin-left: 33.33333333%;
}
.col-xs-offset-3 {
  margin-left: 25%;
}
.col-xs-offset-2 {
  margin-left: 16.66666667%;
}
.col-xs-offset-1 {
  margin-left: 8.33333333%;
}
.col-xs-offset-0 {
  margin-left: 0%;
}
@media (min-width: 768px) {
  .col-sm-1, .col-sm-2, .col-sm-3, .col-sm-4, .col-sm-5, .col-sm-6, .col-sm-7, .col-sm-8, .col-sm-9, .col-sm-10, .col-sm-11, .col-sm-12 {
    float: left;
  }
  .col-sm-12 {
    width: 100%;
  }
  .col-sm-11 {
    width: 91.66666667%;
  }
  .col-sm-10 {
    width: 83.33333333%;
  }
  .col-sm-9 {
    width: 75%;
  }
  .col-sm-8 {
    width: 66.66666667%;
  }
  .col-sm-7 {
    width: 58.33333333%;
  }
  .col-sm-6 {
    width: 50%;
  }
  .col-sm-5 {
    width: 41.66666667%;
  }
  .col-sm-4 {
    width: 33.33333333%;
  }
  .col-sm-3 {
    width: 25%;
  }
  .col-sm-2 {
    width: 16.66666667%;
  }
  .col-sm-1 {
    width: 8.33333333%;
  }
  .col-sm-pull-12 {
    right: 100%;
  }
  .col-sm-pull-11 {
    right: 91.66666667%;
  }
  .col-sm-pull-10 {
    right: 83.33333333%;
  }
  .col-sm-pull-9 {
    right: 75%;
  }
  .col-sm-pull-8 {
    right: 66.66666667%;
  }
  .col-sm-pull-7 {
    right: 58.33333333%;
  }
  .col-sm-pull-6 {
    right: 50%;
  }
  .col-sm-pull-5 {
    right: 41.66666667%;
  }
  .col-sm-pull-4 {
    right: 33.33333333%;
  }
  .col-sm-pull-3 {
    right: 25%;
  }
  .col-sm-pull-2 {
    right: 16.66666667%;
  }
  .col-sm-pull-1 {
    right: 8.33333333%;
  }
  .col-sm-pull-0 {
    right: auto;
  }
  .col-sm-push-12 {
    left: 100%;
  }
  .col-sm-push-11 {
    left: 91.66666667%;
  }
  .col-sm-push-10 {
    left: 83.33333333%;
  }
  .col-sm-push-9 {
    left: 75%;
  }
  .col-sm-push-8 {
    left: 66.66666667%;
  }
  .col-sm-push-7 {
    left: 58.33333333%;
  }
  .col-sm-push-6 {
    left: 50%;
  }
  .col-sm-push-5 {
    left: 41.66666667%;
  }
  .col-sm-push-4 {
    left: 33.33333333%;
  }
  .col-sm-push-3 {
    left: 25%;
  }
  .col-sm-push-2 {
    left: 16.66666667%;
  }
  .col-sm-push-1 {
    left: 8.33333333%;
  }
  .col-sm-push-0 {
    left: auto;
  }
  .col-sm-offset-12 {
    margin-left: 100%;
  }
  .col-sm-offset-11 {
    margin-left: 91.66666667%;
  }
  .col-sm-offset-10 {
    margin-left: 83.33333333%;
  }
  .col-sm-offset-9 {
    margin-left: 75%;
  }
  .col-sm-offset-8 {
    margin-left: 66.66666667%;
  }
  .col-sm-offset-7 {
    margin-left: 58.33333333%;
  }
  .col-sm-offset-6 {
    margin-left: 50%;
  }
  .col-sm-offset-5 {
    margin-left: 41.66666667%;
  }
  .col-sm-offset-4 {
    margin-left: 33.33333333%;
  }
  .col-sm-offset-3 {
    margin-left: 25%;
  }
  .col-sm-offset-2 {
    margin-left: 16.66666667%;
  }
  .col-sm-offset-1 {
    margin-left: 8.33333333%;
  }
  .col-sm-offset-0 {
    margin-left: 0%;
  }
}
@media (min-width: 992px) {
  .col-md-1, .col-md-2, .col-md-3, .col-md-4, .col-md-5, .col-md-6, .col-md-7, .col-md-8, .col-md-9, .col-md-10, .col-md-11, .col-md-12 {
    float: left;
  }
  .col-md-12 {
    width: 100%;
  }
  .col-md-11 {
    width: 91.66666667%;
  }
  .col-md-10 {
    width: 83.33333333%;
  }
  .col-md-9 {
    width: 75%;
  }
  .col-md-8 {
    width: 66.66666667%;
  }
  .col-md-7 {
    width: 58.33333333%;
  }
  .col-md-6 {
    width: 50%;
  }
  .col-md-5 {
    width: 41.66666667%;
  }
  .col-md-4 {
    width: 33.33333333%;
  }
  .col-md-3 {
    width: 25%;
  }
  .col-md-2 {
    width: 16.66666667%;
  }
  .col-md-1 {
    width: 8.33333333%;
  }
  .col-md-pull-12 {
    right: 100%;
  }
  .col-md-pull-11 {
    right: 91.66666667%;
  }
  .col-md-pull-10 {
    right: 83.33333333%;
  }
  .col-md-pull-9 {
    right: 75%;
  }
  .col-md-pull-8 {
    right: 66.66666667%;
  }
  .col-md-pull-7 {
    right: 58.33333333%;
  }
  .col-md-pull-6 {
    right: 50%;
  }
  .col-md-pull-5 {
    right: 41.66666667%;
  }
  .col-md-pull-4 {
    right: 33.33333333%;
  }
  .col-md-pull-3 {
    right: 25%;
  }
  .col-md-pull-2 {
    right: 16.66666667%;
  }
  .col-md-pull-1 {
    right: 8.33333333%;
  }
  .col-md-pull-0 {
    right: auto;
  }
  .col-md-push-12 {
    left: 100%;
  }
  .col-md-push-11 {
    left: 91.66666667%;
  }
  .col-md-push-10 {
    left: 83.33333333%;
  }
  .col-md-push-9 {
    left: 75%;
  }
  .col-md-push-8 {
    left: 66.66666667%;
  }
  .col-md-push-7 {
    left: 58.33333333%;
  }
  .col-md-push-6 {
    left: 50%;
  }
  .col-md-push-5 {
    left: 41.66666667%;
  }
  .col-md-push-4 {
    left: 33.33333333%;
  }
  .col-md-push-3 {
    left: 25%;
  }
  .col-md-push-2 {
    left: 16.66666667%;
  }
  .col-md-push-1 {
    left: 8.33333333%;
  }
  .col-md-push-0 {
    left: auto;
  }
  .col-md-offset-12 {
    margin-left: 100%;
  }
  .col-md-offset-11 {
    margin-left: 91.66666667%;
  }
  .col-md-offset-10 {
    margin-left: 83.33333333%;
  }
  .col-md-offset-9 {
    margin-left: 75%;
  }
  .col-md-offset-8 {
    margin-left: 66.66666667%;
  }
  .col-md-offset-7 {
    margin-left: 58.33333333%;
  }
  .col-md-offset-6 {
    margin-left: 50%;
  }
  .col-md-offset-5 {
    margin-left: 41.66666667%;
  }
  .col-md-offset-4 {
    margin-left: 33.33333333%;
  }
  .col-md-offset-3 {
    margin-left: 25%;
  }
  .col-md-offset-2 {
    margin-left: 16.66666667%;
  }
  .col-md-offset-1 {
    margin-left: 8.33333333%;
  }
  .col-md-offset-0 {
    margin-left: 0%;
  }
}
@media (min-width: 1200px) {
  .col-lg-1, .col-lg-2, .col-lg-3, .col-lg-4, .col-lg-5, .col-lg-6, .col-lg-7, .col-lg-8, .col-lg-9, .col-lg-10, .col-lg-11, .col-lg-12 {
    float: left;
  }
  .col-lg-12 {
    width: 100%;
  }
  .col-lg-11 {
    width: 91.66666667%;
  }
  .col-lg-10 {
    width: 83.33333333%;
  }
  .col-lg-9 {
    width: 75%;
  }
  .col-lg-8 {
    width: 66.66666667%;
  }
  .col-lg-7 {
    width: 58.33333333%;
  }
  .col-lg-6 {
    width: 50%;
  }
  .col-lg-5 {
    width: 41.66666667%;
  }
  .col-lg-4 {
    width: 33.33333333%;
  }
  .col-lg-3 {
    width: 25%;
  }
  .col-lg-2 {
    width: 16.66666667%;
  }
  .col-lg-1 {
    width: 8.33333333%;
  }
  .col-lg-pull-12 {
    right: 100%;
  }
  .col-lg-pull-11 {
    right: 91.66666667%;
  }
  .col-lg-pull-10 {
    right: 83.33333333%;
  }
  .col-lg-pull-9 {
    right: 75%;
  }
  .col-lg-pull-8 {
    right: 66.66666667%;
  }
  .col-lg-pull-7 {
    right: 58.33333333%;
  }
  .col-lg-pull-6 {
    right: 50%;
  }
  .col-lg-pull-5 {
    right: 41.66666667%;
  }
  .col-lg-pull-4 {
    right: 33.33333333%;
  }
  .col-lg-pull-3 {
    right: 25%;
  }
  .col-lg-pull-2 {
    right: 16.66666667%;
  }
  .col-lg-pull-1 {
    right: 8.33333333%;
  }
  .col-lg-pull-0 {
    right: auto;
  }
  .col-lg-push-12 {
    left: 100%;
  }
  .col-lg-push-11 {
    left: 91.66666667%;
  }
  .col-lg-push-10 {
    left: 83.33333333%;
  }
  .col-lg-push-9 {
    left: 75%;
  }
  .col-lg-push-8 {
    left: 66.66666667%;
  }
  .col-lg-push-7 {
    left: 58.33333333%;
  }
  .col-lg-push-6 {
    left: 50%;
  }
  .col-lg-push-5 {
    left: 41.66666667%;
  }
  .col-lg-push-4 {
    left: 33.33333333%;
  }
  .col-lg-push-3 {
    left: 25%;
  }
  .col-lg-push-2 {
    left: 16.66666667%;
  }
  .col-lg-push-1 {
    left: 8.33333333%;
  }
  .col-lg-push-0 {
    left: auto;
  }
  .col-lg-offset-12 {
    margin-left: 100%;
  }
  .col-lg-offset-11 {
    margin-left: 91.66666667%;
  }
  .col-lg-offset-10 {
    margin-left: 83.33333333%;
  }
  .col-lg-offset-9 {
    margin-left: 75%;
  }
  .col-lg-offset-8 {
    margin-left: 66.66666667%;
  }
  .col-lg-offset-7 {
    margin-left: 58.33333333%;
  }
  .col-lg-offset-6 {
    margin-left: 50%;
  }
  .col-lg-offset-5 {
    margin-left: 41.66666667%;
  }
  .col-lg-offset-4 {
    margin-left: 33.33333333%;
  }
  .col-lg-offset-3 {
    margin-left: 25%;
  }
  .col-lg-offset-2 {
    margin-left: 16.66666667%;
  }
  .col-lg-offset-1 {
    margin-left: 8.33333333%;
  }
  .col-lg-offset-0 {
    margin-left: 0%;
  }
}
table {
  background-color: transparent;
}
caption {
  padding-top: 8px;
  padding-bottom: 8px;
  color: #777777;
  text-align: left;
}
th {
  text-align: left;
}
.table {
  width: 100%;
  max-width: 100%;
  margin-bottom: 18px;
}
.table > thead > tr > th,
.table > tbody > tr > th,
.table > tfoot > tr > th,
.table > thead > tr > td,
.table > tbody > tr > td,
.table > tfoot > tr > td {
  padding: 8px;
  line-height: 1.42857143;
  vertical-align: top;
  border-top: 1px solid #ddd;
}
.table > thead > tr > th {
  vertical-align: bottom;
  border-bottom: 2px solid #ddd;
}
.table > caption + thead > tr:first-child > th,
.table > colgroup + thead > tr:first-child > th,
.table > thead:first-child > tr:first-child > th,
.table > caption + thead > tr:first-child > td,
.table > colgroup + thead > tr:first-child > td,
.table > thead:first-child > tr:first-child > td {
  border-top: 0;
}
.table > tbody + tbody {
  border-top: 2px solid #ddd;
}
.table .table {
  background-color: #fff;
}
.table-condensed > thead > tr > th,
.table-condensed > tbody > tr > th,
.table-condensed > tfoot > tr > th,
.table-condensed > thead > tr > td,
.table-condensed > tbody > tr > td,
.table-condensed > tfoot > tr > td {
  padding: 5px;
}
.table-bordered {
  border: 1px solid #ddd;
}
.table-bordered > thead > tr > th,
.table-bordered > tbody > tr > th,
.table-bordered > tfoot > tr > th,
.table-bordered > thead > tr > td,
.table-bordered > tbody > tr > td,
.table-bordered > tfoot > tr > td {
  border: 1px solid #ddd;
}
.table-bordered > thead > tr > th,
.table-bordered > thead > tr > td {
  border-bottom-width: 2px;
}
.table-striped > tbody > tr:nth-of-type(odd) {
  background-color: #f9f9f9;
}
.table-hover > tbody > tr:hover {
  background-color: #f5f5f5;
}
table col[class*="col-"] {
  position: static;
  float: none;
  display: table-column;
}
table td[class*="col-"],
table th[class*="col-"] {
  position: static;
  float: none;
  display: table-cell;
}
.table > thead > tr > td.active,
.table > tbody > tr > td.active,
.table > tfoot > tr > td.active,
.table > thead > tr > th.active,
.table > tbody > tr > th.active,
.table > tfoot > tr > th.active,
.table > thead > tr.active > td,
.table > tbody > tr.active > td,
.table > tfoot > tr.active > td,
.table > thead > tr.active > th,
.table > tbody > tr.active > th,
.table > tfoot > tr.active > th {
  background-color: #f5f5f5;
}
.table-hover > tbody > tr > td.active:hover,
.table-hover > tbody > tr > th.active:hover,
.table-hover > tbody > tr.active:hover > td,
.table-hover > tbody > tr:hover > .active,
.table-hover > tbody > tr.active:hover > th {
  background-color: #e8e8e8;
}
.table > thead > tr > td.success,
.table > tbody > tr > td.success,
.table > tfoot > tr > td.success,
.table > thead > tr > th.success,
.table > tbody > tr > th.success,
.table > tfoot > tr > th.success,
.table > thead > tr.success > td,
.table > tbody > tr.success > td,
.table > tfoot > tr.success > td,
.table > thead > tr.success > th,
.table > tbody > tr.success > th,
.table > tfoot > tr.success > th {
  background-color: #dff0d8;
}
.table-hover > tbody > tr > td.success:hover,
.table-hover > tbody > tr > th.success:hover,
.table-hover > tbody > tr.success:hover > td,
.table-hover > tbody > tr:hover > .success,
.table-hover > tbody > tr.success:hover > th {
  background-color: #d0e9c6;
}
.table > thead > tr > td.info,
.table > tbody > tr > td.info,
.table > tfoot > tr > td.info,
.table > thead > tr > th.info,
.table > tbody > tr > th.info,
.table > tfoot > tr > th.info,
.table > thead > tr.info > td,
.table > tbody > tr.info > td,
.table > tfoot > tr.info > td,
.table > thead > tr.info > th,
.table > tbody > tr.info > th,
.table > tfoot > tr.info > th {
  background-color: #d9edf7;
}
.table-hover > tbody > tr > td.info:hover,
.table-hover > tbody > tr > th.info:hover,
.table-hover > tbody > tr.info:hover > td,
.table-hover > tbody > tr:hover > .info,
.table-hover > tbody > tr.info:hover > th {
  background-color: #c4e3f3;
}
.table > thead > tr > td.warning,
.table > tbody > tr > td.warning,
.table > tfoot > tr > td.warning,
.table > thead > tr > th.warning,
.table > tbody > tr > th.warning,
.table > tfoot > tr > th.warning,
.table > thead > tr.warning > td,
.table > tbody > tr.warning > td,
.table > tfoot > tr.warning > td,
.table > thead > tr.warning > th,
.table > tbody > tr.warning > th,
.table > tfoot > tr.warning > th {
  background-color: #fcf8e3;
}
.table-hover > tbody > tr > td.warning:hover,
.table-hover > tbody > tr > th.warning:hover,
.table-hover > tbody > tr.warning:hover > td,
.table-hover > tbody > tr:hover > .warning,
.table-hover > tbody > tr.warning:hover > th {
  background-color: #faf2cc;
}
.table > thead > tr > td.danger,
.table > tbody > tr > td.danger,
.table > tfoot > tr > td.danger,
.table > thead > tr > th.danger,
.table > tbody > tr > th.danger,
.table > tfoot > tr > th.danger,
.table > thead > tr.danger > td,
.table > tbody > tr.danger > td,
.table > tfoot > tr.danger > td,
.table > thead > tr.danger > th,
.table > tbody > tr.danger > th,
.table > tfoot > tr.danger > th {
  background-color: #f2dede;
}
.table-hover > tbody > tr > td.danger:hover,
.table-hover > tbody > tr > th.danger:hover,
.table-hover > tbody > tr.danger:hover > td,
.table-hover > tbody > tr:hover > .danger,
.table-hover > tbody > tr.danger:hover > th {
  background-color: #ebcccc;
}
.table-responsive {
  overflow-x: auto;
  min-height: 0.01%;
}
@media screen and (max-width: 767px) {
  .table-responsive {
    width: 100%;
    margin-bottom: 13.5px;
    overflow-y: hidden;
    -ms-overflow-style: -ms-autohiding-scrollbar;
    border: 1px solid #ddd;
  }
  .table-responsive > .table {
    margin-bottom: 0;
  }
  .table-responsive > .table > thead > tr > th,
  .table-responsive > .table > tbody > tr > th,
  .table-responsive > .table > tfoot > tr > th,
  .table-responsive > .table > thead > tr > td,
  .table-responsive > .table > tbody > tr > td,
  .table-responsive > .table > tfoot > tr > td {
    white-space: nowrap;
  }
  .table-responsive > .table-bordered {
    border: 0;
  }
  .table-responsive > .table-bordered > thead > tr > th:first-child,
  .table-responsive > .table-bordered > tbody > tr > th:first-child,
  .table-responsive > .table-bordered > tfoot > tr > th:first-child,
  .table-responsive > .table-bordered > thead > tr > td:first-child,
  .table-responsive > .table-bordered > tbody > tr > td:first-child,
  .table-responsive > .table-bordered > tfoot > tr > td:first-child {
    border-left: 0;
  }
  .table-responsive > .table-bordered > thead > tr > th:last-child,
  .table-responsive > .table-bordered > tbody > tr > th:last-child,
  .table-responsive > .table-bordered > tfoot > tr > th:last-child,
  .table-responsive > .table-bordered > thead > tr > td:last-child,
  .table-responsive > .table-bordered > tbody > tr > td:last-child,
  .table-responsive > .table-bordered > tfoot > tr > td:last-child {
    border-right: 0;
  }
  .table-responsive > .table-bordered > tbody > tr:last-child > th,
  .table-responsive > .table-bordered > tfoot > tr:last-child > th,
  .table-responsive > .table-bordered > tbody > tr:last-child > td,
  .table-responsive > .table-bordered > tfoot > tr:last-child > td {
    border-bottom: 0;
  }
}
fieldset {
  padding: 0;
  margin: 0;
  border: 0;
  min-width: 0;
}
legend {
  display: block;
  width: 100%;
  padding: 0;
  margin-bottom: 18px;
  font-size: 19.5px;
  line-height: inherit;
  color: #333333;
  border: 0;
  border-bottom: 1px solid #e5e5e5;
}
label {
  display: inline-block;
  max-width: 100%;
  margin-bottom: 5px;
  font-weight: bold;
}
input[type="search"] {
  -webkit-box-sizing: border-box;
  -moz-box-sizing: border-box;
  box-sizing: border-box;
}
input[type="radio"],
input[type="checkbox"] {
  margin: 4px 0 0;
  margin-top: 1px \9;
  line-height: normal;
}
input[type="file"] {
  display: block;
}
input[type="range"] {
  display: block;
  width: 100%;
}
select[multiple],
select[size] {
  height: auto;
}
input[type="file"]:focus,
input[type="radio"]:focus,
input[type="checkbox"]:focus {
  outline: 5px auto -webkit-focus-ring-color;
  outline-offset: -2px;
}
output {
  display: block;
  padding-top: 7px;
  font-size: 13px;
  line-height: 1.42857143;
  color: #555555;
}
.form-control {
  display: block;
  width: 100%;
  height: 32px;
  padding: 6px 12px;
  font-size: 13px;
  line-height: 1.42857143;
  color: #555555;
  background-color: #fff;
  background-image: none;
  border: 1px solid #ccc;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  -webkit-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  -o-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
}
.form-control:focus {
  border-color: #66afe9;
  outline: 0;
  -webkit-box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, 0.6);
  box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, 0.6);
}
.form-control::-moz-placeholder {
  color: #999;
  opacity: 1;
}
.form-control:-ms-input-placeholder {
  color: #999;
}
.form-control::-webkit-input-placeholder {
  color: #999;
}
.form-control::-ms-expand {
  border: 0;
  background-color: transparent;
}
.form-control[disabled],
.form-control[readonly],
fieldset[disabled] .form-control {
  background-color: #eeeeee;
  opacity: 1;
}
.form-control[disabled],
fieldset[disabled] .form-control {
  cursor: not-allowed;
}
textarea.form-control {
  height: auto;
}
input[type="search"] {
  -webkit-appearance: none;
}
@media screen and (-webkit-min-device-pixel-ratio: 0) {
  input[type="date"].form-control,
  input[type="time"].form-control,
  input[type="datetime-local"].form-control,
  input[type="month"].form-control {
    line-height: 32px;
  }
  input[type="date"].input-sm,
  input[type="time"].input-sm,
  input[type="datetime-local"].input-sm,
  input[type="month"].input-sm,
  .input-group-sm input[type="date"],
  .input-group-sm input[type="time"],
  .input-group-sm input[type="datetime-local"],
  .input-group-sm input[type="month"] {
    line-height: 30px;
  }
  input[type="date"].input-lg,
  input[type="time"].input-lg,
  input[type="datetime-local"].input-lg,
  input[type="month"].input-lg,
  .input-group-lg input[type="date"],
  .input-group-lg input[type="time"],
  .input-group-lg input[type="datetime-local"],
  .input-group-lg input[type="month"] {
    line-height: 45px;
  }
}
.form-group {
  margin-bottom: 15px;
}
.radio,
.checkbox {
  position: relative;
  display: block;
  margin-top: 10px;
  margin-bottom: 10px;
}
.radio label,
.checkbox label {
  min-height: 18px;
  padding-left: 20px;
  margin-bottom: 0;
  font-weight: normal;
  cursor: pointer;
}
.radio input[type="radio"],
.radio-inline input[type="radio"],
.checkbox input[type="checkbox"],
.checkbox-inline input[type="checkbox"] {
  position: absolute;
  margin-left: -20px;
  margin-top: 4px \9;
}
.radio + .radio,
.checkbox + .checkbox {
  margin-top: -5px;
}
.radio-inline,
.checkbox-inline {
  position: relative;
  display: inline-block;
  padding-left: 20px;
  margin-bottom: 0;
  vertical-align: middle;
  font-weight: normal;
  cursor: pointer;
}
.radio-inline + .radio-inline,
.checkbox-inline + .checkbox-inline {
  margin-top: 0;
  margin-left: 10px;
}
input[type="radio"][disabled],
input[type="checkbox"][disabled],
input[type="radio"].disabled,
input[type="checkbox"].disabled,
fieldset[disabled] input[type="radio"],
fieldset[disabled] input[type="checkbox"] {
  cursor: not-allowed;
}
.radio-inline.disabled,
.checkbox-inline.disabled,
fieldset[disabled] .radio-inline,
fieldset[disabled] .checkbox-inline {
  cursor: not-allowed;
}
.radio.disabled label,
.checkbox.disabled label,
fieldset[disabled] .radio label,
fieldset[disabled] .checkbox label {
  cursor: not-allowed;
}
.form-control-static {
  padding-top: 7px;
  padding-bottom: 7px;
  margin-bottom: 0;
  min-height: 31px;
}
.form-control-static.input-lg,
.form-control-static.input-sm {
  padding-left: 0;
  padding-right: 0;
}
.input-sm {
  height: 30px;
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
}
select.input-sm {
  height: 30px;
  line-height: 30px;
}
textarea.input-sm,
select[multiple].input-sm {
  height: auto;
}
.form-group-sm .form-control {
  height: 30px;
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
}
.form-group-sm select.form-control {
  height: 30px;
  line-height: 30px;
}
.form-group-sm textarea.form-control,
.form-group-sm select[multiple].form-control {
  height: auto;
}
.form-group-sm .form-control-static {
  height: 30px;
  min-height: 30px;
  padding: 6px 10px;
  font-size: 12px;
  line-height: 1.5;
}
.input-lg {
  height: 45px;
  padding: 10px 16px;
  font-size: 17px;
  line-height: 1.3333333;
  border-radius: 3px;
}
select.input-lg {
  height: 45px;
  line-height: 45px;
}
textarea.input-lg,
select[multiple].input-lg {
  height: auto;
}
.form-group-lg .form-control {
  height: 45px;
  padding: 10px 16px;
  font-size: 17px;
  line-height: 1.3333333;
  border-radius: 3px;
}
.form-group-lg select.form-control {
  height: 45px;
  line-height: 45px;
}
.form-group-lg textarea.form-control,
.form-group-lg select[multiple].form-control {
  height: auto;
}
.form-group-lg .form-control-static {
  height: 45px;
  min-height: 35px;
  padding: 11px 16px;
  font-size: 17px;
  line-height: 1.3333333;
}
.has-feedback {
  position: relative;
}
.has-feedback .form-control {
  padding-right: 40px;
}
.form-control-feedback {
  position: absolute;
  top: 0;
  right: 0;
  z-index: 2;
  display: block;
  width: 32px;
  height: 32px;
  line-height: 32px;
  text-align: center;
  pointer-events: none;
}
.input-lg + .form-control-feedback,
.input-group-lg + .form-control-feedback,
.form-group-lg .form-control + .form-control-feedback {
  width: 45px;
  height: 45px;
  line-height: 45px;
}
.input-sm + .form-control-feedback,
.input-group-sm + .form-control-feedback,
.form-group-sm .form-control + .form-control-feedback {
  width: 30px;
  height: 30px;
  line-height: 30px;
}
.has-success .help-block,
.has-success .control-label,
.has-success .radio,
.has-success .checkbox,
.has-success .radio-inline,
.has-success .checkbox-inline,
.has-success.radio label,
.has-success.checkbox label,
.has-success.radio-inline label,
.has-success.checkbox-inline label {
  color: #3c763d;
}
.has-success .form-control {
  border-color: #3c763d;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
}
.has-success .form-control:focus {
  border-color: #2b542c;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #67b168;
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #67b168;
}
.has-success .input-group-addon {
  color: #3c763d;
  border-color: #3c763d;
  background-color: #dff0d8;
}
.has-success .form-control-feedback {
  color: #3c763d;
}
.has-warning .help-block,
.has-warning .control-label,
.has-warning .radio,
.has-warning .checkbox,
.has-warning .radio-inline,
.has-warning .checkbox-inline,
.has-warning.radio label,
.has-warning.checkbox label,
.has-warning.radio-inline label,
.has-warning.checkbox-inline label {
  color: #8a6d3b;
}
.has-warning .form-control {
  border-color: #8a6d3b;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
}
.has-warning .form-control:focus {
  border-color: #66512c;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #c0a16b;
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #c0a16b;
}
.has-warning .input-group-addon {
  color: #8a6d3b;
  border-color: #8a6d3b;
  background-color: #fcf8e3;
}
.has-warning .form-control-feedback {
  color: #8a6d3b;
}
.has-error .help-block,
.has-error .control-label,
.has-error .radio,
.has-error .checkbox,
.has-error .radio-inline,
.has-error .checkbox-inline,
.has-error.radio label,
.has-error.checkbox label,
.has-error.radio-inline label,
.has-error.checkbox-inline label {
  color: #a94442;
}
.has-error .form-control {
  border-color: #a94442;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
}
.has-error .form-control:focus {
  border-color: #843534;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #ce8483;
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #ce8483;
}
.has-error .input-group-addon {
  color: #a94442;
  border-color: #a94442;
  background-color: #f2dede;
}
.has-error .form-control-feedback {
  color: #a94442;
}
.has-feedback label ~ .form-control-feedback {
  top: 23px;
}
.has-feedback label.sr-only ~ .form-control-feedback {
  top: 0;
}
.help-block {
  display: block;
  margin-top: 5px;
  margin-bottom: 10px;
  color: #404040;
}
@media (min-width: 768px) {
  .form-inline .form-group {
    display: inline-block;
    margin-bottom: 0;
    vertical-align: middle;
  }
  .form-inline .form-control {
    display: inline-block;
    width: auto;
    vertical-align: middle;
  }
  .form-inline .form-control-static {
    display: inline-block;
  }
  .form-inline .input-group {
    display: inline-table;
    vertical-align: middle;
  }
  .form-inline .input-group .input-group-addon,
  .form-inline .input-group .input-group-btn,
  .form-inline .input-group .form-control {
    width: auto;
  }
  .form-inline .input-group > .form-control {
    width: 100%;
  }
  .form-inline .control-label {
    margin-bottom: 0;
    vertical-align: middle;
  }
  .form-inline .radio,
  .form-inline .checkbox {
    display: inline-block;
    margin-top: 0;
    margin-bottom: 0;
    vertical-align: middle;
  }
  .form-inline .radio label,
  .form-inline .checkbox label {
    padding-left: 0;
  }
  .form-inline .radio input[type="radio"],
  .form-inline .checkbox input[type="checkbox"] {
    position: relative;
    margin-left: 0;
  }
  .form-inline .has-feedback .form-control-feedback {
    top: 0;
  }
}
.form-horizontal .radio,
.form-horizontal .checkbox,
.form-horizontal .radio-inline,
.form-horizontal .checkbox-inline {
  margin-top: 0;
  margin-bottom: 0;
  padding-top: 7px;
}
.form-horizontal .radio,
.form-horizontal .checkbox {
  min-height: 25px;
}
.form-horizontal .form-group {
  margin-left: 0px;
  margin-right: 0px;
}
@media (min-width: 768px) {
  .form-horizontal .control-label {
    text-align: right;
    margin-bottom: 0;
    padding-top: 7px;
  }
}
.form-horizontal .has-feedback .form-control-feedback {
  right: 0px;
}
@media (min-width: 768px) {
  .form-horizontal .form-group-lg .control-label {
    padding-top: 11px;
    font-size: 17px;
  }
}
@media (min-width: 768px) {
  .form-horizontal .form-group-sm .control-label {
    padding-top: 6px;
    font-size: 12px;
  }
}
.btn {
  display: inline-block;
  margin-bottom: 0;
  font-weight: normal;
  text-align: center;
  vertical-align: middle;
  touch-action: manipulation;
  cursor: pointer;
  background-image: none;
  border: 1px solid transparent;
  white-space: nowrap;
  padding: 6px 12px;
  font-size: 13px;
  line-height: 1.42857143;
  border-radius: 2px;
  -webkit-user-select: none;
  -moz-user-select: none;
  -ms-user-select: none;
  user-select: none;
}
.btn:focus,
.btn:active:focus,
.btn.active:focus,
.btn.focus,
.btn:active.focus,
.btn.active.focus {
  outline: 5px auto -webkit-focus-ring-color;
  outline-offset: -2px;
}
.btn:hover,
.btn:focus,
.btn.focus {
  color: #333;
  text-decoration: none;
}
.btn:active,
.btn.active {
  outline: 0;
  background-image: none;
  -webkit-box-shadow: inset 0 3px 5px rgba(0, 0, 0, 0.125);
  box-shadow: inset 0 3px 5px rgba(0, 0, 0, 0.125);
}
.btn.disabled,
.btn[disabled],
fieldset[disabled] .btn {
  cursor: not-allowed;
  opacity: 0.65;
  filter: alpha(opacity=65);
  -webkit-box-shadow: none;
  box-shadow: none;
}
a.btn.disabled,
fieldset[disabled] a.btn {
  pointer-events: none;
}
.btn-default {
  color: #333;
  background-color: #fff;
  border-color: #ccc;
}
.btn-default:focus,
.btn-default.focus {
  color: #333;
  background-color: #e6e6e6;
  border-color: #8c8c8c;
}
.btn-default:hover {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
.btn-default:active,
.btn-default.active,
.open > .dropdown-toggle.btn-default {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
.btn-default:active:hover,
.btn-default.active:hover,
.open > .dropdown-toggle.btn-default:hover,
.btn-default:active:focus,
.btn-default.active:focus,
.open > .dropdown-toggle.btn-default:focus,
.btn-default:active.focus,
.btn-default.active.focus,
.open > .dropdown-toggle.btn-default.focus {
  color: #333;
  background-color: #d4d4d4;
  border-color: #8c8c8c;
}
.btn-default:active,
.btn-default.active,
.open > .dropdown-toggle.btn-default {
  background-image: none;
}
.btn-default.disabled:hover,
.btn-default[disabled]:hover,
fieldset[disabled] .btn-default:hover,
.btn-default.disabled:focus,
.btn-default[disabled]:focus,
fieldset[disabled] .btn-default:focus,
.btn-default.disabled.focus,
.btn-default[disabled].focus,
fieldset[disabled] .btn-default.focus {
  background-color: #fff;
  border-color: #ccc;
}
.btn-default .badge {
  color: #fff;
  background-color: #333;
}
.btn-primary {
  color: #fff;
  background-color: #337ab7;
  border-color: #2e6da4;
}
.btn-primary:focus,
.btn-primary.focus {
  color: #fff;
  background-color: #286090;
  border-color: #122b40;
}
.btn-primary:hover {
  color: #fff;
  background-color: #286090;
  border-color: #204d74;
}
.btn-primary:active,
.btn-primary.active,
.open > .dropdown-toggle.btn-primary {
  color: #fff;
  background-color: #286090;
  border-color: #204d74;
}
.btn-primary:active:hover,
.btn-primary.active:hover,
.open > .dropdown-toggle.btn-primary:hover,
.btn-primary:active:focus,
.btn-primary.active:focus,
.open > .dropdown-toggle.btn-primary:focus,
.btn-primary:active.focus,
.btn-primary.active.focus,
.open > .dropdown-toggle.btn-primary.focus {
  color: #fff;
  background-color: #204d74;
  border-color: #122b40;
}
.btn-primary:active,
.btn-primary.active,
.open > .dropdown-toggle.btn-primary {
  background-image: none;
}
.btn-primary.disabled:hover,
.btn-primary[disabled]:hover,
fieldset[disabled] .btn-primary:hover,
.btn-primary.disabled:focus,
.btn-primary[disabled]:focus,
fieldset[disabled] .btn-primary:focus,
.btn-primary.disabled.focus,
.btn-primary[disabled].focus,
fieldset[disabled] .btn-primary.focus {
  background-color: #337ab7;
  border-color: #2e6da4;
}
.btn-primary .badge {
  color: #337ab7;
  background-color: #fff;
}
.btn-success {
  color: #fff;
  background-color: #5cb85c;
  border-color: #4cae4c;
}
.btn-success:focus,
.btn-success.focus {
  color: #fff;
  background-color: #449d44;
  border-color: #255625;
}
.btn-success:hover {
  color: #fff;
  background-color: #449d44;
  border-color: #398439;
}
.btn-success:active,
.btn-success.active,
.open > .dropdown-toggle.btn-success {
  color: #fff;
  background-color: #449d44;
  border-color: #398439;
}
.btn-success:active:hover,
.btn-success.active:hover,
.open > .dropdown-toggle.btn-success:hover,
.btn-success:active:focus,
.btn-success.active:focus,
.open > .dropdown-toggle.btn-success:focus,
.btn-success:active.focus,
.btn-success.active.focus,
.open > .dropdown-toggle.btn-success.focus {
  color: #fff;
  background-color: #398439;
  border-color: #255625;
}
.btn-success:active,
.btn-success.active,
.open > .dropdown-toggle.btn-success {
  background-image: none;
}
.btn-success.disabled:hover,
.btn-success[disabled]:hover,
fieldset[disabled] .btn-success:hover,
.btn-success.disabled:focus,
.btn-success[disabled]:focus,
fieldset[disabled] .btn-success:focus,
.btn-success.disabled.focus,
.btn-success[disabled].focus,
fieldset[disabled] .btn-success.focus {
  background-color: #5cb85c;
  border-color: #4cae4c;
}
.btn-success .badge {
  color: #5cb85c;
  background-color: #fff;
}
.btn-info {
  color: #fff;
  background-color: #5bc0de;
  border-color: #46b8da;
}
.btn-info:focus,
.btn-info.focus {
  color: #fff;
  background-color: #31b0d5;
  border-color: #1b6d85;
}
.btn-info:hover {
  color: #fff;
  background-color: #31b0d5;
  border-color: #269abc;
}
.btn-info:active,
.btn-info.active,
.open > .dropdown-toggle.btn-info {
  color: #fff;
  background-color: #31b0d5;
  border-color: #269abc;
}
.btn-info:active:hover,
.btn-info.active:hover,
.open > .dropdown-toggle.btn-info:hover,
.btn-info:active:focus,
.btn-info.active:focus,
.open > .dropdown-toggle.btn-info:focus,
.btn-info:active.focus,
.btn-info.active.focus,
.open > .dropdown-toggle.btn-info.focus {
  color: #fff;
  background-color: #269abc;
  border-color: #1b6d85;
}
.btn-info:active,
.btn-info.active,
.open > .dropdown-toggle.btn-info {
  background-image: none;
}
.btn-info.disabled:hover,
.btn-info[disabled]:hover,
fieldset[disabled] .btn-info:hover,
.btn-info.disabled:focus,
.btn-info[disabled]:focus,
fieldset[disabled] .btn-info:focus,
.btn-info.disabled.focus,
.btn-info[disabled].focus,
fieldset[disabled] .btn-info.focus {
  background-color: #5bc0de;
  border-color: #46b8da;
}
.btn-info .badge {
  color: #5bc0de;
  background-color: #fff;
}
.btn-warning {
  color: #fff;
  background-color: #f0ad4e;
  border-color: #eea236;
}
.btn-warning:focus,
.btn-warning.focus {
  color: #fff;
  background-color: #ec971f;
  border-color: #985f0d;
}
.btn-warning:hover {
  color: #fff;
  background-color: #ec971f;
  border-color: #d58512;
}
.btn-warning:active,
.btn-warning.active,
.open > .dropdown-toggle.btn-warning {
  color: #fff;
  background-color: #ec971f;
  border-color: #d58512;
}
.btn-warning:active:hover,
.btn-warning.active:hover,
.open > .dropdown-toggle.btn-warning:hover,
.btn-warning:active:focus,
.btn-warning.active:focus,
.open > .dropdown-toggle.btn-warning:focus,
.btn-warning:active.focus,
.btn-warning.active.focus,
.open > .dropdown-toggle.btn-warning.focus {
  color: #fff;
  background-color: #d58512;
  border-color: #985f0d;
}
.btn-warning:active,
.btn-warning.active,
.open > .dropdown-toggle.btn-warning {
  background-image: none;
}
.btn-warning.disabled:hover,
.btn-warning[disabled]:hover,
fieldset[disabled] .btn-warning:hover,
.btn-warning.disabled:focus,
.btn-warning[disabled]:focus,
fieldset[disabled] .btn-warning:focus,
.btn-warning.disabled.focus,
.btn-warning[disabled].focus,
fieldset[disabled] .btn-warning.focus {
  background-color: #f0ad4e;
  border-color: #eea236;
}
.btn-warning .badge {
  color: #f0ad4e;
  background-color: #fff;
}
.btn-danger {
  color: #fff;
  background-color: #d9534f;
  border-color: #d43f3a;
}
.btn-danger:focus,
.btn-danger.focus {
  color: #fff;
  background-color: #c9302c;
  border-color: #761c19;
}
.btn-danger:hover {
  color: #fff;
  background-color: #c9302c;
  border-color: #ac2925;
}
.btn-danger:active,
.btn-danger.active,
.open > .dropdown-toggle.btn-danger {
  color: #fff;
  background-color: #c9302c;
  border-color: #ac2925;
}
.btn-danger:active:hover,
.btn-danger.active:hover,
.open > .dropdown-toggle.btn-danger:hover,
.btn-danger:active:focus,
.btn-danger.active:focus,
.open > .dropdown-toggle.btn-danger:focus,
.btn-danger:active.focus,
.btn-danger.active.focus,
.open > .dropdown-toggle.btn-danger.focus {
  color: #fff;
  background-color: #ac2925;
  border-color: #761c19;
}
.btn-danger:active,
.btn-danger.active,
.open > .dropdown-toggle.btn-danger {
  background-image: none;
}
.btn-danger.disabled:hover,
.btn-danger[disabled]:hover,
fieldset[disabled] .btn-danger:hover,
.btn-danger.disabled:focus,
.btn-danger[disabled]:focus,
fieldset[disabled] .btn-danger:focus,
.btn-danger.disabled.focus,
.btn-danger[disabled].focus,
fieldset[disabled] .btn-danger.focus {
  background-color: #d9534f;
  border-color: #d43f3a;
}
.btn-danger .badge {
  color: #d9534f;
  background-color: #fff;
}
.btn-link {
  color: #337ab7;
  font-weight: normal;
  border-radius: 0;
}
.btn-link,
.btn-link:active,
.btn-link.active,
.btn-link[disabled],
fieldset[disabled] .btn-link {
  background-color: transparent;
  -webkit-box-shadow: none;
  box-shadow: none;
}
.btn-link,
.btn-link:hover,
.btn-link:focus,
.btn-link:active {
  border-color: transparent;
}
.btn-link:hover,
.btn-link:focus {
  color: #23527c;
  text-decoration: underline;
  background-color: transparent;
}
.btn-link[disabled]:hover,
fieldset[disabled] .btn-link:hover,
.btn-link[disabled]:focus,
fieldset[disabled] .btn-link:focus {
  color: #777777;
  text-decoration: none;
}
.btn-lg,
.btn-group-lg > .btn {
  padding: 10px 16px;
  font-size: 17px;
  line-height: 1.3333333;
  border-radius: 3px;
}
.btn-sm,
.btn-group-sm > .btn {
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
}
.btn-xs,
.btn-group-xs > .btn {
  padding: 1px 5px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
}
.btn-block {
  display: block;
  width: 100%;
}
.btn-block + .btn-block {
  margin-top: 5px;
}
input[type="submit"].btn-block,
input[type="reset"].btn-block,
input[type="button"].btn-block {
  width: 100%;
}
.fade {
  opacity: 0;
  -webkit-transition: opacity 0.15s linear;
  -o-transition: opacity 0.15s linear;
  transition: opacity 0.15s linear;
}
.fade.in {
  opacity: 1;
}
.collapse {
  display: none;
}
.collapse.in {
  display: block;
}
tr.collapse.in {
  display: table-row;
}
tbody.collapse.in {
  display: table-row-group;
}
.collapsing {
  position: relative;
  height: 0;
  overflow: hidden;
  -webkit-transition-property: height, visibility;
  transition-property: height, visibility;
  -webkit-transition-duration: 0.35s;
  transition-duration: 0.35s;
  -webkit-transition-timing-function: ease;
  transition-timing-function: ease;
}
.caret {
  display: inline-block;
  width: 0;
  height: 0;
  margin-left: 2px;
  vertical-align: middle;
  border-top: 4px dashed;
  border-top: 4px solid \9;
  border-right: 4px solid transparent;
  border-left: 4px solid transparent;
}
.dropup,
.dropdown {
  position: relative;
}
.dropdown-toggle:focus {
  outline: 0;
}
.dropdown-menu {
  position: absolute;
  top: 100%;
  left: 0;
  z-index: 1000;
  display: none;
  float: left;
  min-width: 160px;
  padding: 5px 0;
  margin: 2px 0 0;
  list-style: none;
  font-size: 13px;
  text-align: left;
  background-color: #fff;
  border: 1px solid #ccc;
  border: 1px solid rgba(0, 0, 0, 0.15);
  border-radius: 2px;
  -webkit-box-shadow: 0 6px 12px rgba(0, 0, 0, 0.175);
  box-shadow: 0 6px 12px rgba(0, 0, 0, 0.175);
  background-clip: padding-box;
}
.dropdown-menu.pull-right {
  right: 0;
  left: auto;
}
.dropdown-menu .divider {
  height: 1px;
  margin: 8px 0;
  overflow: hidden;
  background-color: #e5e5e5;
}
.dropdown-menu > li > a {
  display: block;
  padding: 3px 20px;
  clear: both;
  font-weight: normal;
  line-height: 1.42857143;
  color: #333333;
  white-space: nowrap;
}
.dropdown-menu > li > a:hover,
.dropdown-menu > li > a:focus {
  text-decoration: none;
  color: #262626;
  background-color: #f5f5f5;
}
.dropdown-menu > .active > a,
.dropdown-menu > .active > a:hover,
.dropdown-menu > .active > a:focus {
  color: #fff;
  text-decoration: none;
  outline: 0;
  background-color: #337ab7;
}
.dropdown-menu > .disabled > a,
.dropdown-menu > .disabled > a:hover,
.dropdown-menu > .disabled > a:focus {
  color: #777777;
}
.dropdown-menu > .disabled > a:hover,
.dropdown-menu > .disabled > a:focus {
  text-decoration: none;
  background-color: transparent;
  background-image: none;
  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);
  cursor: not-allowed;
}
.open > .dropdown-menu {
  display: block;
}
.open > a {
  outline: 0;
}
.dropdown-menu-right {
  left: auto;
  right: 0;
}
.dropdown-menu-left {
  left: 0;
  right: auto;
}
.dropdown-header {
  display: block;
  padding: 3px 20px;
  font-size: 12px;
  line-height: 1.42857143;
  color: #777777;
  white-space: nowrap;
}
.dropdown-backdrop {
  position: fixed;
  left: 0;
  right: 0;
  bottom: 0;
  top: 0;
  z-index: 990;
}
.pull-right > .dropdown-menu {
  right: 0;
  left: auto;
}
.dropup .caret,
.navbar-fixed-bottom .dropdown .caret {
  border-top: 0;
  border-bottom: 4px dashed;
  border-bottom: 4px solid \9;
  content: "";
}
.dropup .dropdown-menu,
.navbar-fixed-bottom .dropdown .dropdown-menu {
  top: auto;
  bottom: 100%;
  margin-bottom: 2px;
}
@media (min-width: 541px) {
  .navbar-right .dropdown-menu {
    left: auto;
    right: 0;
  }
  .navbar-right .dropdown-menu-left {
    left: 0;
    right: auto;
  }
}
.btn-group,
.btn-group-vertical {
  position: relative;
  display: inline-block;
  vertical-align: middle;
}
.btn-group > .btn,
.btn-group-vertical > .btn {
  position: relative;
  float: left;
}
.btn-group > .btn:hover,
.btn-group-vertical > .btn:hover,
.btn-group > .btn:focus,
.btn-group-vertical > .btn:focus,
.btn-group > .btn:active,
.btn-group-vertical > .btn:active,
.btn-group > .btn.active,
.btn-group-vertical > .btn.active {
  z-index: 2;
}
.btn-group .btn + .btn,
.btn-group .btn + .btn-group,
.btn-group .btn-group + .btn,
.btn-group .btn-group + .btn-group {
  margin-left: -1px;
}
.btn-toolbar {
  margin-left: -5px;
}
.btn-toolbar .btn,
.btn-toolbar .btn-group,
.btn-toolbar .input-group {
  float: left;
}
.btn-toolbar > .btn,
.btn-toolbar > .btn-group,
.btn-toolbar > .input-group {
  margin-left: 5px;
}
.btn-group > .btn:not(:first-child):not(:last-child):not(.dropdown-toggle) {
  border-radius: 0;
}
.btn-group > .btn:first-child {
  margin-left: 0;
}
.btn-group > .btn:first-child:not(:last-child):not(.dropdown-toggle) {
  border-bottom-right-radius: 0;
  border-top-right-radius: 0;
}
.btn-group > .btn:last-child:not(:first-child),
.btn-group > .dropdown-toggle:not(:first-child) {
  border-bottom-left-radius: 0;
  border-top-left-radius: 0;
}
.btn-group > .btn-group {
  float: left;
}
.btn-group > .btn-group:not(:first-child):not(:last-child) > .btn {
  border-radius: 0;
}
.btn-group > .btn-group:first-child:not(:last-child) > .btn:last-child,
.btn-group > .btn-group:first-child:not(:last-child) > .dropdown-toggle {
  border-bottom-right-radius: 0;
  border-top-right-radius: 0;
}
.btn-group > .btn-group:last-child:not(:first-child) > .btn:first-child {
  border-bottom-left-radius: 0;
  border-top-left-radius: 0;
}
.btn-group .dropdown-toggle:active,
.btn-group.open .dropdown-toggle {
  outline: 0;
}
.btn-group > .btn + .dropdown-toggle {
  padding-left: 8px;
  padding-right: 8px;
}
.btn-group > .btn-lg + .dropdown-toggle {
  padding-left: 12px;
  padding-right: 12px;
}
.btn-group.open .dropdown-toggle {
  -webkit-box-shadow: inset 0 3px 5px rgba(0, 0, 0, 0.125);
  box-shadow: inset 0 3px 5px rgba(0, 0, 0, 0.125);
}
.btn-group.open .dropdown-toggle.btn-link {
  -webkit-box-shadow: none;
  box-shadow: none;
}
.btn .caret {
  margin-left: 0;
}
.btn-lg .caret {
  border-width: 5px 5px 0;
  border-bottom-width: 0;
}
.dropup .btn-lg .caret {
  border-width: 0 5px 5px;
}
.btn-group-vertical > .btn,
.btn-group-vertical > .btn-group,
.btn-group-vertical > .btn-group > .btn {
  display: block;
  float: none;
  width: 100%;
  max-width: 100%;
}
.btn-group-vertical > .btn-group > .btn {
  float: none;
}
.btn-group-vertical > .btn + .btn,
.btn-group-vertical > .btn + .btn-group,
.btn-group-vertical > .btn-group + .btn,
.btn-group-vertical > .btn-group + .btn-group {
  margin-top: -1px;
  margin-left: 0;
}
.btn-group-vertical > .btn:not(:first-child):not(:last-child) {
  border-radius: 0;
}
.btn-group-vertical > .btn:first-child:not(:last-child) {
  border-top-right-radius: 2px;
  border-top-left-radius: 2px;
  border-bottom-right-radius: 0;
  border-bottom-left-radius: 0;
}
.btn-group-vertical > .btn:last-child:not(:first-child) {
  border-top-right-radius: 0;
  border-top-left-radius: 0;
  border-bottom-right-radius: 2px;
  border-bottom-left-radius: 2px;
}
.btn-group-vertical > .btn-group:not(:first-child):not(:last-child) > .btn {
  border-radius: 0;
}
.btn-group-vertical > .btn-group:first-child:not(:last-child) > .btn:last-child,
.btn-group-vertical > .btn-group:first-child:not(:last-child) > .dropdown-toggle {
  border-bottom-right-radius: 0;
  border-bottom-left-radius: 0;
}
.btn-group-vertical > .btn-group:last-child:not(:first-child) > .btn:first-child {
  border-top-right-radius: 0;
  border-top-left-radius: 0;
}
.btn-group-justified {
  display: table;
  width: 100%;
  table-layout: fixed;
  border-collapse: separate;
}
.btn-group-justified > .btn,
.btn-group-justified > .btn-group {
  float: none;
  display: table-cell;
  width: 1%;
}
.btn-group-justified > .btn-group .btn {
  width: 100%;
}
.btn-group-justified > .btn-group .dropdown-menu {
  left: auto;
}
[data-toggle="buttons"] > .btn input[type="radio"],
[data-toggle="buttons"] > .btn-group > .btn input[type="radio"],
[data-toggle="buttons"] > .btn input[type="checkbox"],
[data-toggle="buttons"] > .btn-group > .btn input[type="checkbox"] {
  position: absolute;
  clip: rect(0, 0, 0, 0);
  pointer-events: none;
}
.input-group {
  position: relative;
  display: table;
  border-collapse: separate;
}
.input-group[class*="col-"] {
  float: none;
  padding-left: 0;
  padding-right: 0;
}
.input-group .form-control {
  position: relative;
  z-index: 2;
  float: left;
  width: 100%;
  margin-bottom: 0;
}
.input-group .form-control:focus {
  z-index: 3;
}
.input-group-lg > .form-control,
.input-group-lg > .input-group-addon,
.input-group-lg > .input-group-btn > .btn {
  height: 45px;
  padding: 10px 16px;
  font-size: 17px;
  line-height: 1.3333333;
  border-radius: 3px;
}
select.input-group-lg > .form-control,
select.input-group-lg > .input-group-addon,
select.input-group-lg > .input-group-btn > .btn {
  height: 45px;
  line-height: 45px;
}
textarea.input-group-lg > .form-control,
textarea.input-group-lg > .input-group-addon,
textarea.input-group-lg > .input-group-btn > .btn,
select[multiple].input-group-lg > .form-control,
select[multiple].input-group-lg > .input-group-addon,
select[multiple].input-group-lg > .input-group-btn > .btn {
  height: auto;
}
.input-group-sm > .form-control,
.input-group-sm > .input-group-addon,
.input-group-sm > .input-group-btn > .btn {
  height: 30px;
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
}
select.input-group-sm > .form-control,
select.input-group-sm > .input-group-addon,
select.input-group-sm > .input-group-btn > .btn {
  height: 30px;
  line-height: 30px;
}
textarea.input-group-sm > .form-control,
textarea.input-group-sm > .input-group-addon,
textarea.input-group-sm > .input-group-btn > .btn,
select[multiple].input-group-sm > .form-control,
select[multiple].input-group-sm > .input-group-addon,
select[multiple].input-group-sm > .input-group-btn > .btn {
  height: auto;
}
.input-group-addon,
.input-group-btn,
.input-group .form-control {
  display: table-cell;
}
.input-group-addon:not(:first-child):not(:last-child),
.input-group-btn:not(:first-child):not(:last-child),
.input-group .form-control:not(:first-child):not(:last-child) {
  border-radius: 0;
}
.input-group-addon,
.input-group-btn {
  width: 1%;
  white-space: nowrap;
  vertical-align: middle;
}
.input-group-addon {
  padding: 6px 12px;
  font-size: 13px;
  font-weight: normal;
  line-height: 1;
  color: #555555;
  text-align: center;
  background-color: #eeeeee;
  border: 1px solid #ccc;
  border-radius: 2px;
}
.input-group-addon.input-sm {
  padding: 5px 10px;
  font-size: 12px;
  border-radius: 1px;
}
.input-group-addon.input-lg {
  padding: 10px 16px;
  font-size: 17px;
  border-radius: 3px;
}
.input-group-addon input[type="radio"],
.input-group-addon input[type="checkbox"] {
  margin-top: 0;
}
.input-group .form-control:first-child,
.input-group-addon:first-child,
.input-group-btn:first-child > .btn,
.input-group-btn:first-child > .btn-group > .btn,
.input-group-btn:first-child > .dropdown-toggle,
.input-group-btn:last-child > .btn:not(:last-child):not(.dropdown-toggle),
.input-group-btn:last-child > .btn-group:not(:last-child) > .btn {
  border-bottom-right-radius: 0;
  border-top-right-radius: 0;
}
.input-group-addon:first-child {
  border-right: 0;
}
.input-group .form-control:last-child,
.input-group-addon:last-child,
.input-group-btn:last-child > .btn,
.input-group-btn:last-child > .btn-group > .btn,
.input-group-btn:last-child > .dropdown-toggle,
.input-group-btn:first-child > .btn:not(:first-child),
.input-group-btn:first-child > .btn-group:not(:first-child) > .btn {
  border-bottom-left-radius: 0;
  border-top-left-radius: 0;
}
.input-group-addon:last-child {
  border-left: 0;
}
.input-group-btn {
  position: relative;
  font-size: 0;
  white-space: nowrap;
}
.input-group-btn > .btn {
  position: relative;
}
.input-group-btn > .btn + .btn {
  margin-left: -1px;
}
.input-group-btn > .btn:hover,
.input-group-btn > .btn:focus,
.input-group-btn > .btn:active {
  z-index: 2;
}
.input-group-btn:first-child > .btn,
.input-group-btn:first-child > .btn-group {
  margin-right: -1px;
}
.input-group-btn:last-child > .btn,
.input-group-btn:last-child > .btn-group {
  z-index: 2;
  margin-left: -1px;
}
.nav {
  margin-bottom: 0;
  padding-left: 0;
  list-style: none;
}
.nav > li {
  position: relative;
  display: block;
}
.nav > li > a {
  position: relative;
  display: block;
  padding: 10px 15px;
}
.nav > li > a:hover,
.nav > li > a:focus {
  text-decoration: none;
  background-color: #eeeeee;
}
.nav > li.disabled > a {
  color: #777777;
}
.nav > li.disabled > a:hover,
.nav > li.disabled > a:focus {
  color: #777777;
  text-decoration: none;
  background-color: transparent;
  cursor: not-allowed;
}
.nav .open > a,
.nav .open > a:hover,
.nav .open > a:focus {
  background-color: #eeeeee;
  border-color: #337ab7;
}
.nav .nav-divider {
  height: 1px;
  margin: 8px 0;
  overflow: hidden;
  background-color: #e5e5e5;
}
.nav > li > a > img {
  max-width: none;
}
.nav-tabs {
  border-bottom: 1px solid #ddd;
}
.nav-tabs > li {
  float: left;
  margin-bottom: -1px;
}
.nav-tabs > li > a {
  margin-right: 2px;
  line-height: 1.42857143;
  border: 1px solid transparent;
  border-radius: 2px 2px 0 0;
}
.nav-tabs > li > a:hover {
  border-color: #eeeeee #eeeeee #ddd;
}
.nav-tabs > li.active > a,
.nav-tabs > li.active > a:hover,
.nav-tabs > li.active > a:focus {
  color: #555555;
  background-color: #fff;
  border: 1px solid #ddd;
  border-bottom-color: transparent;
  cursor: default;
}
.nav-tabs.nav-justified {
  width: 100%;
  border-bottom: 0;
}
.nav-tabs.nav-justified > li {
  float: none;
}
.nav-tabs.nav-justified > li > a {
  text-align: center;
  margin-bottom: 5px;
}
.nav-tabs.nav-justified > .dropdown .dropdown-menu {
  top: auto;
  left: auto;
}
@media (min-width: 768px) {
  .nav-tabs.nav-justified > li {
    display: table-cell;
    width: 1%;
  }
  .nav-tabs.nav-justified > li > a {
    margin-bottom: 0;
  }
}
.nav-tabs.nav-justified > li > a {
  margin-right: 0;
  border-radius: 2px;
}
.nav-tabs.nav-justified > .active > a,
.nav-tabs.nav-justified > .active > a:hover,
.nav-tabs.nav-justified > .active > a:focus {
  border: 1px solid #ddd;
}
@media (min-width: 768px) {
  .nav-tabs.nav-justified > li > a {
    border-bottom: 1px solid #ddd;
    border-radius: 2px 2px 0 0;
  }
  .nav-tabs.nav-justified > .active > a,
  .nav-tabs.nav-justified > .active > a:hover,
  .nav-tabs.nav-justified > .active > a:focus {
    border-bottom-color: #fff;
  }
}
.nav-pills > li {
  float: left;
}
.nav-pills > li > a {
  border-radius: 2px;
}
.nav-pills > li + li {
  margin-left: 2px;
}
.nav-pills > li.active > a,
.nav-pills > li.active > a:hover,
.nav-pills > li.active > a:focus {
  color: #fff;
  background-color: #337ab7;
}
.nav-stacked > li {
  float: none;
}
.nav-stacked > li + li {
  margin-top: 2px;
  margin-left: 0;
}
.nav-justified {
  width: 100%;
}
.nav-justified > li {
  float: none;
}
.nav-justified > li > a {
  text-align: center;
  margin-bottom: 5px;
}
.nav-justified > .dropdown .dropdown-menu {
  top: auto;
  left: auto;
}
@media (min-width: 768px) {
  .nav-justified > li {
    display: table-cell;
    width: 1%;
  }
  .nav-justified > li > a {
    margin-bottom: 0;
  }
}
.nav-tabs-justified {
  border-bottom: 0;
}
.nav-tabs-justified > li > a {
  margin-right: 0;
  border-radius: 2px;
}
.nav-tabs-justified > .active > a,
.nav-tabs-justified > .active > a:hover,
.nav-tabs-justified > .active > a:focus {
  border: 1px solid #ddd;
}
@media (min-width: 768px) {
  .nav-tabs-justified > li > a {
    border-bottom: 1px solid #ddd;
    border-radius: 2px 2px 0 0;
  }
  .nav-tabs-justified > .active > a,
  .nav-tabs-justified > .active > a:hover,
  .nav-tabs-justified > .active > a:focus {
    border-bottom-color: #fff;
  }
}
.tab-content > .tab-pane {
  display: none;
}
.tab-content > .active {
  display: block;
}
.nav-tabs .dropdown-menu {
  margin-top: -1px;
  border-top-right-radius: 0;
  border-top-left-radius: 0;
}
.navbar {
  position: relative;
  min-height: 30px;
  margin-bottom: 18px;
  border: 1px solid transparent;
}
@media (min-width: 541px) {
  .navbar {
    border-radius: 2px;
  }
}
@media (min-width: 541px) {
  .navbar-header {
    float: left;
  }
}
.navbar-collapse {
  overflow-x: visible;
  padding-right: 0px;
  padding-left: 0px;
  border-top: 1px solid transparent;
  box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.1);
  -webkit-overflow-scrolling: touch;
}
.navbar-collapse.in {
  overflow-y: auto;
}
@media (min-width: 541px) {
  .navbar-collapse {
    width: auto;
    border-top: 0;
    box-shadow: none;
  }
  .navbar-collapse.collapse {
    display: block !important;
    height: auto !important;
    padding-bottom: 0;
    overflow: visible !important;
  }
  .navbar-collapse.in {
    overflow-y: visible;
  }
  .navbar-fixed-top .navbar-collapse,
  .navbar-static-top .navbar-collapse,
  .navbar-fixed-bottom .navbar-collapse {
    padding-left: 0;
    padding-right: 0;
  }
}
.navbar-fixed-top .navbar-collapse,
.navbar-fixed-bottom .navbar-collapse {
  max-height: 340px;
}
@media (max-device-width: 540px) and (orientation: landscape) {
  .navbar-fixed-top .navbar-collapse,
  .navbar-fixed-bottom .navbar-collapse {
    max-height: 200px;
  }
}
.container > .navbar-header,
.container-fluid > .navbar-header,
.container > .navbar-collapse,
.container-fluid > .navbar-collapse {
  margin-right: 0px;
  margin-left: 0px;
}
@media (min-width: 541px) {
  .container > .navbar-header,
  .container-fluid > .navbar-header,
  .container > .navbar-collapse,
  .container-fluid > .navbar-collapse {
    margin-right: 0;
    margin-left: 0;
  }
}
.navbar-static-top {
  z-index: 1000;
  border-width: 0 0 1px;
}
@media (min-width: 541px) {
  .navbar-static-top {
    border-radius: 0;
  }
}
.navbar-fixed-top,
.navbar-fixed-bottom {
  position: fixed;
  right: 0;
  left: 0;
  z-index: 1030;
}
@media (min-width: 541px) {
  .navbar-fixed-top,
  .navbar-fixed-bottom {
    border-radius: 0;
  }
}
.navbar-fixed-top {
  top: 0;
  border-width: 0 0 1px;
}
.navbar-fixed-bottom {
  bottom: 0;
  margin-bottom: 0;
  border-width: 1px 0 0;
}
.navbar-brand {
  float: left;
  padding: 6px 0px;
  font-size: 17px;
  line-height: 18px;
  height: 30px;
}
.navbar-brand:hover,
.navbar-brand:focus {
  text-decoration: none;
}
.navbar-brand > img {
  display: block;
}
@media (min-width: 541px) {
  .navbar > .container .navbar-brand,
  .navbar > .container-fluid .navbar-brand {
    margin-left: 0px;
  }
}
.navbar-toggle {
  position: relative;
  float: right;
  margin-right: 0px;
  padding: 9px 10px;
  margin-top: -2px;
  margin-bottom: -2px;
  background-color: transparent;
  background-image: none;
  border: 1px solid transparent;
  border-radius: 2px;
}
.navbar-toggle:focus {
  outline: 0;
}
.navbar-toggle .icon-bar {
  display: block;
  width: 22px;
  height: 2px;
  border-radius: 1px;
}
.navbar-toggle .icon-bar + .icon-bar {
  margin-top: 4px;
}
@media (min-width: 541px) {
  .navbar-toggle {
    display: none;
  }
}
.navbar-nav {
  margin: 3px 0px;
}
.navbar-nav > li > a {
  padding-top: 10px;
  padding-bottom: 10px;
  line-height: 18px;
}
@media (max-width: 540px) {
  .navbar-nav .open .dropdown-menu {
    position: static;
    float: none;
    width: auto;
    margin-top: 0;
    background-color: transparent;
    border: 0;
    box-shadow: none;
  }
  .navbar-nav .open .dropdown-menu > li > a,
  .navbar-nav .open .dropdown-menu .dropdown-header {
    padding: 5px 15px 5px 25px;
  }
  .navbar-nav .open .dropdown-menu > li > a {
    line-height: 18px;
  }
  .navbar-nav .open .dropdown-menu > li > a:hover,
  .navbar-nav .open .dropdown-menu > li > a:focus {
    background-image: none;
  }
}
@media (min-width: 541px) {
  .navbar-nav {
    float: left;
    margin: 0;
  }
  .navbar-nav > li {
    float: left;
  }
  .navbar-nav > li > a {
    padding-top: 6px;
    padding-bottom: 6px;
  }
}
.navbar-form {
  margin-left: 0px;
  margin-right: 0px;
  padding: 10px 0px;
  border-top: 1px solid transparent;
  border-bottom: 1px solid transparent;
  -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.1), 0 1px 0 rgba(255, 255, 255, 0.1);
  box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.1), 0 1px 0 rgba(255, 255, 255, 0.1);
  margin-top: -1px;
  margin-bottom: -1px;
}
@media (min-width: 768px) {
  .navbar-form .form-group {
    display: inline-block;
    margin-bottom: 0;
    vertical-align: middle;
  }
  .navbar-form .form-control {
    display: inline-block;
    width: auto;
    vertical-align: middle;
  }
  .navbar-form .form-control-static {
    display: inline-block;
  }
  .navbar-form .input-group {
    display: inline-table;
    vertical-align: middle;
  }
  .navbar-form .input-group .input-group-addon,
  .navbar-form .input-group .input-group-btn,
  .navbar-form .input-group .form-control {
    width: auto;
  }
  .navbar-form .input-group > .form-control {
    width: 100%;
  }
  .navbar-form .control-label {
    margin-bottom: 0;
    vertical-align: middle;
  }
  .navbar-form .radio,
  .navbar-form .checkbox {
    display: inline-block;
    margin-top: 0;
    margin-bottom: 0;
    vertical-align: middle;
  }
  .navbar-form .radio label,
  .navbar-form .checkbox label {
    padding-left: 0;
  }
  .navbar-form .radio input[type="radio"],
  .navbar-form .checkbox input[type="checkbox"] {
    position: relative;
    margin-left: 0;
  }
  .navbar-form .has-feedback .form-control-feedback {
    top: 0;
  }
}
@media (max-width: 540px) {
  .navbar-form .form-group {
    margin-bottom: 5px;
  }
  .navbar-form .form-group:last-child {
    margin-bottom: 0;
  }
}
@media (min-width: 541px) {
  .navbar-form {
    width: auto;
    border: 0;
    margin-left: 0;
    margin-right: 0;
    padding-top: 0;
    padding-bottom: 0;
    -webkit-box-shadow: none;
    box-shadow: none;
  }
}
.navbar-nav > li > .dropdown-menu {
  margin-top: 0;
  border-top-right-radius: 0;
  border-top-left-radius: 0;
}
.navbar-fixed-bottom .navbar-nav > li > .dropdown-menu {
  margin-bottom: 0;
  border-top-right-radius: 2px;
  border-top-left-radius: 2px;
  border-bottom-right-radius: 0;
  border-bottom-left-radius: 0;
}
.navbar-btn {
  margin-top: -1px;
  margin-bottom: -1px;
}
.navbar-btn.btn-sm {
  margin-top: 0px;
  margin-bottom: 0px;
}
.navbar-btn.btn-xs {
  margin-top: 4px;
  margin-bottom: 4px;
}
.navbar-text {
  margin-top: 6px;
  margin-bottom: 6px;
}
@media (min-width: 541px) {
  .navbar-text {
    float: left;
    margin-left: 0px;
    margin-right: 0px;
  }
}
@media (min-width: 541px) {
  .navbar-left {
    float: left !important;
    float: left;
  }
  .navbar-right {
    float: right !important;
    float: right;
    margin-right: 0px;
  }
  .navbar-right ~ .navbar-right {
    margin-right: 0;
  }
}
.navbar-default {
  background-color: #f8f8f8;
  border-color: #e7e7e7;
}
.navbar-default .navbar-brand {
  color: #777;
}
.navbar-default .navbar-brand:hover,
.navbar-default .navbar-brand:focus {
  color: #5e5e5e;
  background-color: transparent;
}
.navbar-default .navbar-text {
  color: #777;
}
.navbar-default .navbar-nav > li > a {
  color: #777;
}
.navbar-default .navbar-nav > li > a:hover,
.navbar-default .navbar-nav > li > a:focus {
  color: #333;
  background-color: transparent;
}
.navbar-default .navbar-nav > .active > a,
.navbar-default .navbar-nav > .active > a:hover,
.navbar-default .navbar-nav > .active > a:focus {
  color: #555;
  background-color: #e7e7e7;
}
.navbar-default .navbar-nav > .disabled > a,
.navbar-default .navbar-nav > .disabled > a:hover,
.navbar-default .navbar-nav > .disabled > a:focus {
  color: #ccc;
  background-color: transparent;
}
.navbar-default .navbar-toggle {
  border-color: #ddd;
}
.navbar-default .navbar-toggle:hover,
.navbar-default .navbar-toggle:focus {
  background-color: #ddd;
}
.navbar-default .navbar-toggle .icon-bar {
  background-color: #888;
}
.navbar-default .navbar-collapse,
.navbar-default .navbar-form {
  border-color: #e7e7e7;
}
.navbar-default .navbar-nav > .open > a,
.navbar-default .navbar-nav > .open > a:hover,
.navbar-default .navbar-nav > .open > a:focus {
  background-color: #e7e7e7;
  color: #555;
}
@media (max-width: 540px) {
  .navbar-default .navbar-nav .open .dropdown-menu > li > a {
    color: #777;
  }
  .navbar-default .navbar-nav .open .dropdown-menu > li > a:hover,
  .navbar-default .navbar-nav .open .dropdown-menu > li > a:focus {
    color: #333;
    background-color: transparent;
  }
  .navbar-default .navbar-nav .open .dropdown-menu > .active > a,
  .navbar-default .navbar-nav .open .dropdown-menu > .active > a:hover,
  .navbar-default .navbar-nav .open .dropdown-menu > .active > a:focus {
    color: #555;
    background-color: #e7e7e7;
  }
  .navbar-default .navbar-nav .open .dropdown-menu > .disabled > a,
  .navbar-default .navbar-nav .open .dropdown-menu > .disabled > a:hover,
  .navbar-default .navbar-nav .open .dropdown-menu > .disabled > a:focus {
    color: #ccc;
    background-color: transparent;
  }
}
.navbar-default .navbar-link {
  color: #777;
}
.navbar-default .navbar-link:hover {
  color: #333;
}
.navbar-default .btn-link {
  color: #777;
}
.navbar-default .btn-link:hover,
.navbar-default .btn-link:focus {
  color: #333;
}
.navbar-default .btn-link[disabled]:hover,
fieldset[disabled] .navbar-default .btn-link:hover,
.navbar-default .btn-link[disabled]:focus,
fieldset[disabled] .navbar-default .btn-link:focus {
  color: #ccc;
}
.navbar-inverse {
  background-color: #222;
  border-color: #080808;
}
.navbar-inverse .navbar-brand {
  color: #9d9d9d;
}
.navbar-inverse .navbar-brand:hover,
.navbar-inverse .navbar-brand:focus {
  color: #fff;
  background-color: transparent;
}
.navbar-inverse .navbar-text {
  color: #9d9d9d;
}
.navbar-inverse .navbar-nav > li > a {
  color: #9d9d9d;
}
.navbar-inverse .navbar-nav > li > a:hover,
.navbar-inverse .navbar-nav > li > a:focus {
  color: #fff;
  background-color: transparent;
}
.navbar-inverse .navbar-nav > .active > a,
.navbar-inverse .navbar-nav > .active > a:hover,
.navbar-inverse .navbar-nav > .active > a:focus {
  color: #fff;
  background-color: #080808;
}
.navbar-inverse .navbar-nav > .disabled > a,
.navbar-inverse .navbar-nav > .disabled > a:hover,
.navbar-inverse .navbar-nav > .disabled > a:focus {
  color: #444;
  background-color: transparent;
}
.navbar-inverse .navbar-toggle {
  border-color: #333;
}
.navbar-inverse .navbar-toggle:hover,
.navbar-inverse .navbar-toggle:focus {
  background-color: #333;
}
.navbar-inverse .navbar-toggle .icon-bar {
  background-color: #fff;
}
.navbar-inverse .navbar-collapse,
.navbar-inverse .navbar-form {
  border-color: #101010;
}
.navbar-inverse .navbar-nav > .open > a,
.navbar-inverse .navbar-nav > .open > a:hover,
.navbar-inverse .navbar-nav > .open > a:focus {
  background-color: #080808;
  color: #fff;
}
@media (max-width: 540px) {
  .navbar-inverse .navbar-nav .open .dropdown-menu > .dropdown-header {
    border-color: #080808;
  }
  .navbar-inverse .navbar-nav .open .dropdown-menu .divider {
    background-color: #080808;
  }
  .navbar-inverse .navbar-nav .open .dropdown-menu > li > a {
    color: #9d9d9d;
  }
  .navbar-inverse .navbar-nav .open .dropdown-menu > li > a:hover,
  .navbar-inverse .navbar-nav .open .dropdown-menu > li > a:focus {
    color: #fff;
    background-color: transparent;
  }
  .navbar-inverse .navbar-nav .open .dropdown-menu > .active > a,
  .navbar-inverse .navbar-nav .open .dropdown-menu > .active > a:hover,
  .navbar-inverse .navbar-nav .open .dropdown-menu > .active > a:focus {
    color: #fff;
    background-color: #080808;
  }
  .navbar-inverse .navbar-nav .open .dropdown-menu > .disabled > a,
  .navbar-inverse .navbar-nav .open .dropdown-menu > .disabled > a:hover,
  .navbar-inverse .navbar-nav .open .dropdown-menu > .disabled > a:focus {
    color: #444;
    background-color: transparent;
  }
}
.navbar-inverse .navbar-link {
  color: #9d9d9d;
}
.navbar-inverse .navbar-link:hover {
  color: #fff;
}
.navbar-inverse .btn-link {
  color: #9d9d9d;
}
.navbar-inverse .btn-link:hover,
.navbar-inverse .btn-link:focus {
  color: #fff;
}
.navbar-inverse .btn-link[disabled]:hover,
fieldset[disabled] .navbar-inverse .btn-link:hover,
.navbar-inverse .btn-link[disabled]:focus,
fieldset[disabled] .navbar-inverse .btn-link:focus {
  color: #444;
}
.breadcrumb {
  padding: 8px 15px;
  margin-bottom: 18px;
  list-style: none;
  background-color: #f5f5f5;
  border-radius: 2px;
}
.breadcrumb > li {
  display: inline-block;
}
.breadcrumb > li + li:before {
  content: "/\00a0";
  padding: 0 5px;
  color: #5e5e5e;
}
.breadcrumb > .active {
  color: #777777;
}
.pagination {
  display: inline-block;
  padding-left: 0;
  margin: 18px 0;
  border-radius: 2px;
}
.pagination > li {
  display: inline;
}
.pagination > li > a,
.pagination > li > span {
  position: relative;
  float: left;
  padding: 6px 12px;
  line-height: 1.42857143;
  text-decoration: none;
  color: #337ab7;
  background-color: #fff;
  border: 1px solid #ddd;
  margin-left: -1px;
}
.pagination > li:first-child > a,
.pagination > li:first-child > span {
  margin-left: 0;
  border-bottom-left-radius: 2px;
  border-top-left-radius: 2px;
}
.pagination > li:last-child > a,
.pagination > li:last-child > span {
  border-bottom-right-radius: 2px;
  border-top-right-radius: 2px;
}
.pagination > li > a:hover,
.pagination > li > span:hover,
.pagination > li > a:focus,
.pagination > li > span:focus {
  z-index: 2;
  color: #23527c;
  background-color: #eeeeee;
  border-color: #ddd;
}
.pagination > .active > a,
.pagination > .active > span,
.pagination > .active > a:hover,
.pagination > .active > span:hover,
.pagination > .active > a:focus,
.pagination > .active > span:focus {
  z-index: 3;
  color: #fff;
  background-color: #337ab7;
  border-color: #337ab7;
  cursor: default;
}
.pagination > .disabled > span,
.pagination > .disabled > span:hover,
.pagination > .disabled > span:focus,
.pagination > .disabled > a,
.pagination > .disabled > a:hover,
.pagination > .disabled > a:focus {
  color: #777777;
  background-color: #fff;
  border-color: #ddd;
  cursor: not-allowed;
}
.pagination-lg > li > a,
.pagination-lg > li > span {
  padding: 10px 16px;
  font-size: 17px;
  line-height: 1.3333333;
}
.pagination-lg > li:first-child > a,
.pagination-lg > li:first-child > span {
  border-bottom-left-radius: 3px;
  border-top-left-radius: 3px;
}
.pagination-lg > li:last-child > a,
.pagination-lg > li:last-child > span {
  border-bottom-right-radius: 3px;
  border-top-right-radius: 3px;
}
.pagination-sm > li > a,
.pagination-sm > li > span {
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
}
.pagination-sm > li:first-child > a,
.pagination-sm > li:first-child > span {
  border-bottom-left-radius: 1px;
  border-top-left-radius: 1px;
}
.pagination-sm > li:last-child > a,
.pagination-sm > li:last-child > span {
  border-bottom-right-radius: 1px;
  border-top-right-radius: 1px;
}
.pager {
  padding-left: 0;
  margin: 18px 0;
  list-style: none;
  text-align: center;
}
.pager li {
  display: inline;
}
.pager li > a,
.pager li > span {
  display: inline-block;
  padding: 5px 14px;
  background-color: #fff;
  border: 1px solid #ddd;
  border-radius: 15px;
}
.pager li > a:hover,
.pager li > a:focus {
  text-decoration: none;
  background-color: #eeeeee;
}
.pager .next > a,
.pager .next > span {
  float: right;
}
.pager .previous > a,
.pager .previous > span {
  float: left;
}
.pager .disabled > a,
.pager .disabled > a:hover,
.pager .disabled > a:focus,
.pager .disabled > span {
  color: #777777;
  background-color: #fff;
  cursor: not-allowed;
}
.label {
  display: inline;
  padding: .2em .6em .3em;
  font-size: 75%;
  font-weight: bold;
  line-height: 1;
  color: #fff;
  text-align: center;
  white-space: nowrap;
  vertical-align: baseline;
  border-radius: .25em;
}
a.label:hover,
a.label:focus {
  color: #fff;
  text-decoration: none;
  cursor: pointer;
}
.label:empty {
  display: none;
}
.btn .label {
  position: relative;
  top: -1px;
}
.label-default {
  background-color: #777777;
}
.label-default[href]:hover,
.label-default[href]:focus {
  background-color: #5e5e5e;
}
.label-primary {
  background-color: #337ab7;
}
.label-primary[href]:hover,
.label-primary[href]:focus {
  background-color: #286090;
}
.label-success {
  background-color: #5cb85c;
}
.label-success[href]:hover,
.label-success[href]:focus {
  background-color: #449d44;
}
.label-info {
  background-color: #5bc0de;
}
.label-info[href]:hover,
.label-info[href]:focus {
  background-color: #31b0d5;
}
.label-warning {
  background-color: #f0ad4e;
}
.label-warning[href]:hover,
.label-warning[href]:focus {
  background-color: #ec971f;
}
.label-danger {
  background-color: #d9534f;
}
.label-danger[href]:hover,
.label-danger[href]:focus {
  background-color: #c9302c;
}
.badge {
  display: inline-block;
  min-width: 10px;
  padding: 3px 7px;
  font-size: 12px;
  font-weight: bold;
  color: #fff;
  line-height: 1;
  vertical-align: middle;
  white-space: nowrap;
  text-align: center;
  background-color: #777777;
  border-radius: 10px;
}
.badge:empty {
  display: none;
}
.btn .badge {
  position: relative;
  top: -1px;
}
.btn-xs .badge,
.btn-group-xs > .btn .badge {
  top: 0;
  padding: 1px 5px;
}
a.badge:hover,
a.badge:focus {
  color: #fff;
  text-decoration: none;
  cursor: pointer;
}
.list-group-item.active > .badge,
.nav-pills > .active > a > .badge {
  color: #337ab7;
  background-color: #fff;
}
.list-group-item > .badge {
  float: right;
}
.list-group-item > .badge + .badge {
  margin-right: 5px;
}
.nav-pills > li > a > .badge {
  margin-left: 3px;
}
.jumbotron {
  padding-top: 30px;
  padding-bottom: 30px;
  margin-bottom: 30px;
  color: inherit;
  background-color: #eeeeee;
}
.jumbotron h1,
.jumbotron .h1 {
  color: inherit;
}
.jumbotron p {
  margin-bottom: 15px;
  font-size: 20px;
  font-weight: 200;
}
.jumbotron > hr {
  border-top-color: #d5d5d5;
}
.container .jumbotron,
.container-fluid .jumbotron {
  border-radius: 3px;
  padding-left: 0px;
  padding-right: 0px;
}
.jumbotron .container {
  max-width: 100%;
}
@media screen and (min-width: 768px) {
  .jumbotron {
    padding-top: 48px;
    padding-bottom: 48px;
  }
  .container .jumbotron,
  .container-fluid .jumbotron {
    padding-left: 60px;
    padding-right: 60px;
  }
  .jumbotron h1,
  .jumbotron .h1 {
    font-size: 59px;
  }
}
.thumbnail {
  display: block;
  padding: 4px;
  margin-bottom: 18px;
  line-height: 1.42857143;
  background-color: #fff;
  border: 1px solid #ddd;
  border-radius: 2px;
  -webkit-transition: border 0.2s ease-in-out;
  -o-transition: border 0.2s ease-in-out;
  transition: border 0.2s ease-in-out;
}
.thumbnail > img,
.thumbnail a > img {
  margin-left: auto;
  margin-right: auto;
}
a.thumbnail:hover,
a.thumbnail:focus,
a.thumbnail.active {
  border-color: #337ab7;
}
.thumbnail .caption {
  padding: 9px;
  color: #000;
}
.alert {
  padding: 15px;
  margin-bottom: 18px;
  border: 1px solid transparent;
  border-radius: 2px;
}
.alert h4 {
  margin-top: 0;
  color: inherit;
}
.alert .alert-link {
  font-weight: bold;
}
.alert > p,
.alert > ul {
  margin-bottom: 0;
}
.alert > p + p {
  margin-top: 5px;
}
.alert-dismissable,
.alert-dismissible {
  padding-right: 35px;
}
.alert-dismissable .close,
.alert-dismissible .close {
  position: relative;
  top: -2px;
  right: -21px;
  color: inherit;
}
.alert-success {
  background-color: #dff0d8;
  border-color: #d6e9c6;
  color: #3c763d;
}
.alert-success hr {
  border-top-color: #c9e2b3;
}
.alert-success .alert-link {
  color: #2b542c;
}
.alert-info {
  background-color: #d9edf7;
  border-color: #bce8f1;
  color: #31708f;
}
.alert-info hr {
  border-top-color: #a6e1ec;
}
.alert-info .alert-link {
  color: #245269;
}
.alert-warning {
  background-color: #fcf8e3;
  border-color: #faebcc;
  color: #8a6d3b;
}
.alert-warning hr {
  border-top-color: #f7e1b5;
}
.alert-warning .alert-link {
  color: #66512c;
}
.alert-danger {
  background-color: #f2dede;
  border-color: #ebccd1;
  color: #a94442;
}
.alert-danger hr {
  border-top-color: #e4b9c0;
}
.alert-danger .alert-link {
  color: #843534;
}
@-webkit-keyframes progress-bar-stripes {
  from {
    background-position: 40px 0;
  }
  to {
    background-position: 0 0;
  }
}
@keyframes progress-bar-stripes {
  from {
    background-position: 40px 0;
  }
  to {
    background-position: 0 0;
  }
}
.progress {
  overflow: hidden;
  height: 18px;
  margin-bottom: 18px;
  background-color: #f5f5f5;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.1);
  box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.1);
}
.progress-bar {
  float: left;
  width: 0%;
  height: 100%;
  font-size: 12px;
  line-height: 18px;
  color: #fff;
  text-align: center;
  background-color: #337ab7;
  -webkit-box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.15);
  box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.15);
  -webkit-transition: width 0.6s ease;
  -o-transition: width 0.6s ease;
  transition: width 0.6s ease;
}
.progress-striped .progress-bar,
.progress-bar-striped {
  background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-size: 40px 40px;
}
.progress.active .progress-bar,
.progress-bar.active {
  -webkit-animation: progress-bar-stripes 2s linear infinite;
  -o-animation: progress-bar-stripes 2s linear infinite;
  animation: progress-bar-stripes 2s linear infinite;
}
.progress-bar-success {
  background-color: #5cb85c;
}
.progress-striped .progress-bar-success {
  background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
}
.progress-bar-info {
  background-color: #5bc0de;
}
.progress-striped .progress-bar-info {
  background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
}
.progress-bar-warning {
  background-color: #f0ad4e;
}
.progress-striped .progress-bar-warning {
  background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
}
.progress-bar-danger {
  background-color: #d9534f;
}
.progress-striped .progress-bar-danger {
  background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
}
.media {
  margin-top: 15px;
}
.media:first-child {
  margin-top: 0;
}
.media,
.media-body {
  zoom: 1;
  overflow: hidden;
}
.media-body {
  width: 10000px;
}
.media-object {
  display: block;
}
.media-object.img-thumbnail {
  max-width: none;
}
.media-right,
.media > .pull-right {
  padding-left: 10px;
}
.media-left,
.media > .pull-left {
  padding-right: 10px;
}
.media-left,
.media-right,
.media-body {
  display: table-cell;
  vertical-align: top;
}
.media-middle {
  vertical-align: middle;
}
.media-bottom {
  vertical-align: bottom;
}
.media-heading {
  margin-top: 0;
  margin-bottom: 5px;
}
.media-list {
  padding-left: 0;
  list-style: none;
}
.list-group {
  margin-bottom: 20px;
  padding-left: 0;
}
.list-group-item {
  position: relative;
  display: block;
  padding: 10px 15px;
  margin-bottom: -1px;
  background-color: #fff;
  border: 1px solid #ddd;
}
.list-group-item:first-child {
  border-top-right-radius: 2px;
  border-top-left-radius: 2px;
}
.list-group-item:last-child {
  margin-bottom: 0;
  border-bottom-right-radius: 2px;
  border-bottom-left-radius: 2px;
}
a.list-group-item,
button.list-group-item {
  color: #555;
}
a.list-group-item .list-group-item-heading,
button.list-group-item .list-group-item-heading {
  color: #333;
}
a.list-group-item:hover,
button.list-group-item:hover,
a.list-group-item:focus,
button.list-group-item:focus {
  text-decoration: none;
  color: #555;
  background-color: #f5f5f5;
}
button.list-group-item {
  width: 100%;
  text-align: left;
}
.list-group-item.disabled,
.list-group-item.disabled:hover,
.list-group-item.disabled:focus {
  background-color: #eeeeee;
  color: #777777;
  cursor: not-allowed;
}
.list-group-item.disabled .list-group-item-heading,
.list-group-item.disabled:hover .list-group-item-heading,
.list-group-item.disabled:focus .list-group-item-heading {
  color: inherit;
}
.list-group-item.disabled .list-group-item-text,
.list-group-item.disabled:hover .list-group-item-text,
.list-group-item.disabled:focus .list-group-item-text {
  color: #777777;
}
.list-group-item.active,
.list-group-item.active:hover,
.list-group-item.active:focus {
  z-index: 2;
  color: #fff;
  background-color: #337ab7;
  border-color: #337ab7;
}
.list-group-item.active .list-group-item-heading,
.list-group-item.active:hover .list-group-item-heading,
.list-group-item.active:focus .list-group-item-heading,
.list-group-item.active .list-group-item-heading > small,
.list-group-item.active:hover .list-group-item-heading > small,
.list-group-item.active:focus .list-group-item-heading > small,
.list-group-item.active .list-group-item-heading > .small,
.list-group-item.active:hover .list-group-item-heading > .small,
.list-group-item.active:focus .list-group-item-heading > .small {
  color: inherit;
}
.list-group-item.active .list-group-item-text,
.list-group-item.active:hover .list-group-item-text,
.list-group-item.active:focus .list-group-item-text {
  color: #c7ddef;
}
.list-group-item-success {
  color: #3c763d;
  background-color: #dff0d8;
}
a.list-group-item-success,
button.list-group-item-success {
  color: #3c763d;
}
a.list-group-item-success .list-group-item-heading,
button.list-group-item-success .list-group-item-heading {
  color: inherit;
}
a.list-group-item-success:hover,
button.list-group-item-success:hover,
a.list-group-item-success:focus,
button.list-group-item-success:focus {
  color: #3c763d;
  background-color: #d0e9c6;
}
a.list-group-item-success.active,
button.list-group-item-success.active,
a.list-group-item-success.active:hover,
button.list-group-item-success.active:hover,
a.list-group-item-success.active:focus,
button.list-group-item-success.active:focus {
  color: #fff;
  background-color: #3c763d;
  border-color: #3c763d;
}
.list-group-item-info {
  color: #31708f;
  background-color: #d9edf7;
}
a.list-group-item-info,
button.list-group-item-info {
  color: #31708f;
}
a.list-group-item-info .list-group-item-heading,
button.list-group-item-info .list-group-item-heading {
  color: inherit;
}
a.list-group-item-info:hover,
button.list-group-item-info:hover,
a.list-group-item-info:focus,
button.list-group-item-info:focus {
  color: #31708f;
  background-color: #c4e3f3;
}
a.list-group-item-info.active,
button.list-group-item-info.active,
a.list-group-item-info.active:hover,
button.list-group-item-info.active:hover,
a.list-group-item-info.active:focus,
button.list-group-item-info.active:focus {
  color: #fff;
  background-color: #31708f;
  border-color: #31708f;
}
.list-group-item-warning {
  color: #8a6d3b;
  background-color: #fcf8e3;
}
a.list-group-item-warning,
button.list-group-item-warning {
  color: #8a6d3b;
}
a.list-group-item-warning .list-group-item-heading,
button.list-group-item-warning .list-group-item-heading {
  color: inherit;
}
a.list-group-item-warning:hover,
button.list-group-item-warning:hover,
a.list-group-item-warning:focus,
button.list-group-item-warning:focus {
  color: #8a6d3b;
  background-color: #faf2cc;
}
a.list-group-item-warning.active,
button.list-group-item-warning.active,
a.list-group-item-warning.active:hover,
button.list-group-item-warning.active:hover,
a.list-group-item-warning.active:focus,
button.list-group-item-warning.active:focus {
  color: #fff;
  background-color: #8a6d3b;
  border-color: #8a6d3b;
}
.list-group-item-danger {
  color: #a94442;
  background-color: #f2dede;
}
a.list-group-item-danger,
button.list-group-item-danger {
  color: #a94442;
}
a.list-group-item-danger .list-group-item-heading,
button.list-group-item-danger .list-group-item-heading {
  color: inherit;
}
a.list-group-item-danger:hover,
button.list-group-item-danger:hover,
a.list-group-item-danger:focus,
button.list-group-item-danger:focus {
  color: #a94442;
  background-color: #ebcccc;
}
a.list-group-item-danger.active,
button.list-group-item-danger.active,
a.list-group-item-danger.active:hover,
button.list-group-item-danger.active:hover,
a.list-group-item-danger.active:focus,
button.list-group-item-danger.active:focus {
  color: #fff;
  background-color: #a94442;
  border-color: #a94442;
}
.list-group-item-heading {
  margin-top: 0;
  margin-bottom: 5px;
}
.list-group-item-text {
  margin-bottom: 0;
  line-height: 1.3;
}
.panel {
  margin-bottom: 18px;
  background-color: #fff;
  border: 1px solid transparent;
  border-radius: 2px;
  -webkit-box-shadow: 0 1px 1px rgba(0, 0, 0, 0.05);
  box-shadow: 0 1px 1px rgba(0, 0, 0, 0.05);
}
.panel-body {
  padding: 15px;
}
.panel-heading {
  padding: 10px 15px;
  border-bottom: 1px solid transparent;
  border-top-right-radius: 1px;
  border-top-left-radius: 1px;
}
.panel-heading > .dropdown .dropdown-toggle {
  color: inherit;
}
.panel-title {
  margin-top: 0;
  margin-bottom: 0;
  font-size: 15px;
  color: inherit;
}
.panel-title > a,
.panel-title > small,
.panel-title > .small,
.panel-title > small > a,
.panel-title > .small > a {
  color: inherit;
}
.panel-footer {
  padding: 10px 15px;
  background-color: #f5f5f5;
  border-top: 1px solid #ddd;
  border-bottom-right-radius: 1px;
  border-bottom-left-radius: 1px;
}
.panel > .list-group,
.panel > .panel-collapse > .list-group {
  margin-bottom: 0;
}
.panel > .list-group .list-group-item,
.panel > .panel-collapse > .list-group .list-group-item {
  border-width: 1px 0;
  border-radius: 0;
}
.panel > .list-group:first-child .list-group-item:first-child,
.panel > .panel-collapse > .list-group:first-child .list-group-item:first-child {
  border-top: 0;
  border-top-right-radius: 1px;
  border-top-left-radius: 1px;
}
.panel > .list-group:last-child .list-group-item:last-child,
.panel > .panel-collapse > .list-group:last-child .list-group-item:last-child {
  border-bottom: 0;
  border-bottom-right-radius: 1px;
  border-bottom-left-radius: 1px;
}
.panel > .panel-heading + .panel-collapse > .list-group .list-group-item:first-child {
  border-top-right-radius: 0;
  border-top-left-radius: 0;
}
.panel-heading + .list-group .list-group-item:first-child {
  border-top-width: 0;
}
.list-group + .panel-footer {
  border-top-width: 0;
}
.panel > .table,
.panel > .table-responsive > .table,
.panel > .panel-collapse > .table {
  margin-bottom: 0;
}
.panel > .table caption,
.panel > .table-responsive > .table caption,
.panel > .panel-collapse > .table caption {
  padding-left: 15px;
  padding-right: 15px;
}
.panel > .table:first-child,
.panel > .table-responsive:first-child > .table:first-child {
  border-top-right-radius: 1px;
  border-top-left-radius: 1px;
}
.panel > .table:first-child > thead:first-child > tr:first-child,
.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child,
.panel > .table:first-child > tbody:first-child > tr:first-child,
.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child {
  border-top-left-radius: 1px;
  border-top-right-radius: 1px;
}
.panel > .table:first-child > thead:first-child > tr:first-child td:first-child,
.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child td:first-child,
.panel > .table:first-child > tbody:first-child > tr:first-child td:first-child,
.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child td:first-child,
.panel > .table:first-child > thead:first-child > tr:first-child th:first-child,
.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child th:first-child,
.panel > .table:first-child > tbody:first-child > tr:first-child th:first-child,
.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child th:first-child {
  border-top-left-radius: 1px;
}
.panel > .table:first-child > thead:first-child > tr:first-child td:last-child,
.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child td:last-child,
.panel > .table:first-child > tbody:first-child > tr:first-child td:last-child,
.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child td:last-child,
.panel > .table:first-child > thead:first-child > tr:first-child th:last-child,
.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child th:last-child,
.panel > .table:first-child > tbody:first-child > tr:first-child th:last-child,
.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child th:last-child {
  border-top-right-radius: 1px;
}
.panel > .table:last-child,
.panel > .table-responsive:last-child > .table:last-child {
  border-bottom-right-radius: 1px;
  border-bottom-left-radius: 1px;
}
.panel > .table:last-child > tbody:last-child > tr:last-child,
.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child,
.panel > .table:last-child > tfoot:last-child > tr:last-child,
.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child {
  border-bottom-left-radius: 1px;
  border-bottom-right-radius: 1px;
}
.panel > .table:last-child > tbody:last-child > tr:last-child td:first-child,
.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child td:first-child,
.panel > .table:last-child > tfoot:last-child > tr:last-child td:first-child,
.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child td:first-child,
.panel > .table:last-child > tbody:last-child > tr:last-child th:first-child,
.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child th:first-child,
.panel > .table:last-child > tfoot:last-child > tr:last-child th:first-child,
.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child th:first-child {
  border-bottom-left-radius: 1px;
}
.panel > .table:last-child > tbody:last-child > tr:last-child td:last-child,
.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child td:last-child,
.panel > .table:last-child > tfoot:last-child > tr:last-child td:last-child,
.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child td:last-child,
.panel > .table:last-child > tbody:last-child > tr:last-child th:last-child,
.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child th:last-child,
.panel > .table:last-child > tfoot:last-child > tr:last-child th:last-child,
.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child th:last-child {
  border-bottom-right-radius: 1px;
}
.panel > .panel-body + .table,
.panel > .panel-body + .table-responsive,
.panel > .table + .panel-body,
.panel > .table-responsive + .panel-body {
  border-top: 1px solid #ddd;
}
.panel > .table > tbody:first-child > tr:first-child th,
.panel > .table > tbody:first-child > tr:first-child td {
  border-top: 0;
}
.panel > .table-bordered,
.panel > .table-responsive > .table-bordered {
  border: 0;
}
.panel > .table-bordered > thead > tr > th:first-child,
.panel > .table-responsive > .table-bordered > thead > tr > th:first-child,
.panel > .table-bordered > tbody > tr > th:first-child,
.panel > .table-responsive > .table-bordered > tbody > tr > th:first-child,
.panel > .table-bordered > tfoot > tr > th:first-child,
.panel > .table-responsive > .table-bordered > tfoot > tr > th:first-child,
.panel > .table-bordered > thead > tr > td:first-child,
.panel > .table-responsive > .table-bordered > thead > tr > td:first-child,
.panel > .table-bordered > tbody > tr > td:first-child,
.panel > .table-responsive > .table-bordered > tbody > tr > td:first-child,
.panel > .table-bordered > tfoot > tr > td:first-child,
.panel > .table-responsive > .table-bordered > tfoot > tr > td:first-child {
  border-left: 0;
}
.panel > .table-bordered > thead > tr > th:last-child,
.panel > .table-responsive > .table-bordered > thead > tr > th:last-child,
.panel > .table-bordered > tbody > tr > th:last-child,
.panel > .table-responsive > .table-bordered > tbody > tr > th:last-child,
.panel > .table-bordered > tfoot > tr > th:last-child,
.panel > .table-responsive > .table-bordered > tfoot > tr > th:last-child,
.panel > .table-bordered > thead > tr > td:last-child,
.panel > .table-responsive > .table-bordered > thead > tr > td:last-child,
.panel > .table-bordered > tbody > tr > td:last-child,
.panel > .table-responsive > .table-bordered > tbody > tr > td:last-child,
.panel > .table-bordered > tfoot > tr > td:last-child,
.panel > .table-responsive > .table-bordered > tfoot > tr > td:last-child {
  border-right: 0;
}
.panel > .table-bordered > thead > tr:first-child > td,
.panel > .table-responsive > .table-bordered > thead > tr:first-child > td,
.panel > .table-bordered > tbody > tr:first-child > td,
.panel > .table-responsive > .table-bordered > tbody > tr:first-child > td,
.panel > .table-bordered > thead > tr:first-child > th,
.panel > .table-responsive > .table-bordered > thead > tr:first-child > th,
.panel > .table-bordered > tbody > tr:first-child > th,
.panel > .table-responsive > .table-bordered > tbody > tr:first-child > th {
  border-bottom: 0;
}
.panel > .table-bordered > tbody > tr:last-child > td,
.panel > .table-responsive > .table-bordered > tbody > tr:last-child > td,
.panel > .table-bordered > tfoot > tr:last-child > td,
.panel > .table-responsive > .table-bordered > tfoot > tr:last-child > td,
.panel > .table-bordered > tbody > tr:last-child > th,
.panel > .table-responsive > .table-bordered > tbody > tr:last-child > th,
.panel > .table-bordered > tfoot > tr:last-child > th,
.panel > .table-responsive > .table-bordered > tfoot > tr:last-child > th {
  border-bottom: 0;
}
.panel > .table-responsive {
  border: 0;
  margin-bottom: 0;
}
.panel-group {
  margin-bottom: 18px;
}
.panel-group .panel {
  margin-bottom: 0;
  border-radius: 2px;
}
.panel-group .panel + .panel {
  margin-top: 5px;
}
.panel-group .panel-heading {
  border-bottom: 0;
}
.panel-group .panel-heading + .panel-collapse > .panel-body,
.panel-group .panel-heading + .panel-collapse > .list-group {
  border-top: 1px solid #ddd;
}
.panel-group .panel-footer {
  border-top: 0;
}
.panel-group .panel-footer + .panel-collapse .panel-body {
  border-bottom: 1px solid #ddd;
}
.panel-default {
  border-color: #ddd;
}
.panel-default > .panel-heading {
  color: #333333;
  background-color: #f5f5f5;
  border-color: #ddd;
}
.panel-default > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #ddd;
}
.panel-default > .panel-heading .badge {
  color: #f5f5f5;
  background-color: #333333;
}
.panel-default > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #ddd;
}
.panel-primary {
  border-color: #337ab7;
}
.panel-primary > .panel-heading {
  color: #fff;
  background-color: #337ab7;
  border-color: #337ab7;
}
.panel-primary > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #337ab7;
}
.panel-primary > .panel-heading .badge {
  color: #337ab7;
  background-color: #fff;
}
.panel-primary > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #337ab7;
}
.panel-success {
  border-color: #d6e9c6;
}
.panel-success > .panel-heading {
  color: #3c763d;
  background-color: #dff0d8;
  border-color: #d6e9c6;
}
.panel-success > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #d6e9c6;
}
.panel-success > .panel-heading .badge {
  color: #dff0d8;
  background-color: #3c763d;
}
.panel-success > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #d6e9c6;
}
.panel-info {
  border-color: #bce8f1;
}
.panel-info > .panel-heading {
  color: #31708f;
  background-color: #d9edf7;
  border-color: #bce8f1;
}
.panel-info > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #bce8f1;
}
.panel-info > .panel-heading .badge {
  color: #d9edf7;
  background-color: #31708f;
}
.panel-info > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #bce8f1;
}
.panel-warning {
  border-color: #faebcc;
}
.panel-warning > .panel-heading {
  color: #8a6d3b;
  background-color: #fcf8e3;
  border-color: #faebcc;
}
.panel-warning > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #faebcc;
}
.panel-warning > .panel-heading .badge {
  color: #fcf8e3;
  background-color: #8a6d3b;
}
.panel-warning > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #faebcc;
}
.panel-danger {
  border-color: #ebccd1;
}
.panel-danger > .panel-heading {
  color: #a94442;
  background-color: #f2dede;
  border-color: #ebccd1;
}
.panel-danger > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #ebccd1;
}
.panel-danger > .panel-heading .badge {
  color: #f2dede;
  background-color: #a94442;
}
.panel-danger > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #ebccd1;
}
.embed-responsive {
  position: relative;
  display: block;
  height: 0;
  padding: 0;
  overflow: hidden;
}
.embed-responsive .embed-responsive-item,
.embed-responsive iframe,
.embed-responsive embed,
.embed-responsive object,
.embed-responsive video {
  position: absolute;
  top: 0;
  left: 0;
  bottom: 0;
  height: 100%;
  width: 100%;
  border: 0;
}
.embed-responsive-16by9 {
  padding-bottom: 56.25%;
}
.embed-responsive-4by3 {
  padding-bottom: 75%;
}
.well {
  min-height: 20px;
  padding: 19px;
  margin-bottom: 20px;
  background-color: #f5f5f5;
  border: 1px solid #e3e3e3;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.05);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.05);
}
.well blockquote {
  border-color: #ddd;
  border-color: rgba(0, 0, 0, 0.15);
}
.well-lg {
  padding: 24px;
  border-radius: 3px;
}
.well-sm {
  padding: 9px;
  border-radius: 1px;
}
.close {
  float: right;
  font-size: 19.5px;
  font-weight: bold;
  line-height: 1;
  color: #000;
  text-shadow: 0 1px 0 #fff;
  opacity: 0.2;
  filter: alpha(opacity=20);
}
.close:hover,
.close:focus {
  color: #000;
  text-decoration: none;
  cursor: pointer;
  opacity: 0.5;
  filter: alpha(opacity=50);
}
button.close {
  padding: 0;
  cursor: pointer;
  background: transparent;
  border: 0;
  -webkit-appearance: none;
}
.modal-open {
  overflow: hidden;
}
.modal {
  display: none;
  overflow: hidden;
  position: fixed;
  top: 0;
  right: 0;
  bottom: 0;
  left: 0;
  z-index: 1050;
  -webkit-overflow-scrolling: touch;
  outline: 0;
}
.modal.fade .modal-dialog {
  -webkit-transform: translate(0, -25%);
  -ms-transform: translate(0, -25%);
  -o-transform: translate(0, -25%);
  transform: translate(0, -25%);
  -webkit-transition: -webkit-transform 0.3s ease-out;
  -moz-transition: -moz-transform 0.3s ease-out;
  -o-transition: -o-transform 0.3s ease-out;
  transition: transform 0.3s ease-out;
}
.modal.in .modal-dialog {
  -webkit-transform: translate(0, 0);
  -ms-transform: translate(0, 0);
  -o-transform: translate(0, 0);
  transform: translate(0, 0);
}
.modal-open .modal {
  overflow-x: hidden;
  overflow-y: auto;
}
.modal-dialog {
  position: relative;
  width: auto;
  margin: 10px;
}
.modal-content {
  position: relative;
  background-color: #fff;
  border: 1px solid #999;
  border: 1px solid rgba(0, 0, 0, 0.2);
  border-radius: 3px;
  -webkit-box-shadow: 0 3px 9px rgba(0, 0, 0, 0.5);
  box-shadow: 0 3px 9px rgba(0, 0, 0, 0.5);
  background-clip: padding-box;
  outline: 0;
}
.modal-backdrop {
  position: fixed;
  top: 0;
  right: 0;
  bottom: 0;
  left: 0;
  z-index: 1040;
  background-color: #000;
}
.modal-backdrop.fade {
  opacity: 0;
  filter: alpha(opacity=0);
}
.modal-backdrop.in {
  opacity: 0.5;
  filter: alpha(opacity=50);
}
.modal-header {
  padding: 15px;
  border-bottom: 1px solid #e5e5e5;
}
.modal-header .close {
  margin-top: -2px;
}
.modal-title {
  margin: 0;
  line-height: 1.42857143;
}
.modal-body {
  position: relative;
  padding: 15px;
}
.modal-footer {
  padding: 15px;
  text-align: right;
  border-top: 1px solid #e5e5e5;
}
.modal-footer .btn + .btn {
  margin-left: 5px;
  margin-bottom: 0;
}
.modal-footer .btn-group .btn + .btn {
  margin-left: -1px;
}
.modal-footer .btn-block + .btn-block {
  margin-left: 0;
}
.modal-scrollbar-measure {
  position: absolute;
  top: -9999px;
  width: 50px;
  height: 50px;
  overflow: scroll;
}
@media (min-width: 768px) {
  .modal-dialog {
    width: 600px;
    margin: 30px auto;
  }
  .modal-content {
    -webkit-box-shadow: 0 5px 15px rgba(0, 0, 0, 0.5);
    box-shadow: 0 5px 15px rgba(0, 0, 0, 0.5);
  }
  .modal-sm {
    width: 300px;
  }
}
@media (min-width: 992px) {
  .modal-lg {
    width: 900px;
  }
}
.tooltip {
  position: absolute;
  z-index: 1070;
  display: block;
  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
  font-style: normal;
  font-weight: normal;
  letter-spacing: normal;
  line-break: auto;
  line-height: 1.42857143;
  text-align: left;
  text-align: start;
  text-decoration: none;
  text-shadow: none;
  text-transform: none;
  white-space: normal;
  word-break: normal;
  word-spacing: normal;
  word-wrap: normal;
  font-size: 12px;
  opacity: 0;
  filter: alpha(opacity=0);
}
.tooltip.in {
  opacity: 0.9;
  filter: alpha(opacity=90);
}
.tooltip.top {
  margin-top: -3px;
  padding: 5px 0;
}
.tooltip.right {
  margin-left: 3px;
  padding: 0 5px;
}
.tooltip.bottom {
  margin-top: 3px;
  padding: 5px 0;
}
.tooltip.left {
  margin-left: -3px;
  padding: 0 5px;
}
.tooltip-inner {
  max-width: 200px;
  padding: 3px 8px;
  color: #fff;
  text-align: center;
  background-color: #000;
  border-radius: 2px;
}
.tooltip-arrow {
  position: absolute;
  width: 0;
  height: 0;
  border-color: transparent;
  border-style: solid;
}
.tooltip.top .tooltip-arrow {
  bottom: 0;
  left: 50%;
  margin-left: -5px;
  border-width: 5px 5px 0;
  border-top-color: #000;
}
.tooltip.top-left .tooltip-arrow {
  bottom: 0;
  right: 5px;
  margin-bottom: -5px;
  border-width: 5px 5px 0;
  border-top-color: #000;
}
.tooltip.top-right .tooltip-arrow {
  bottom: 0;
  left: 5px;
  margin-bottom: -5px;
  border-width: 5px 5px 0;
  border-top-color: #000;
}
.tooltip.right .tooltip-arrow {
  top: 50%;
  left: 0;
  margin-top: -5px;
  border-width: 5px 5px 5px 0;
  border-right-color: #000;
}
.tooltip.left .tooltip-arrow {
  top: 50%;
  right: 0;
  margin-top: -5px;
  border-width: 5px 0 5px 5px;
  border-left-color: #000;
}
.tooltip.bottom .tooltip-arrow {
  top: 0;
  left: 50%;
  margin-left: -5px;
  border-width: 0 5px 5px;
  border-bottom-color: #000;
}
.tooltip.bottom-left .tooltip-arrow {
  top: 0;
  right: 5px;
  margin-top: -5px;
  border-width: 0 5px 5px;
  border-bottom-color: #000;
}
.tooltip.bottom-right .tooltip-arrow {
  top: 0;
  left: 5px;
  margin-top: -5px;
  border-width: 0 5px 5px;
  border-bottom-color: #000;
}
.popover {
  position: absolute;
  top: 0;
  left: 0;
  z-index: 1060;
  display: none;
  max-width: 276px;
  padding: 1px;
  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
  font-style: normal;
  font-weight: normal;
  letter-spacing: normal;
  line-break: auto;
  line-height: 1.42857143;
  text-align: left;
  text-align: start;
  text-decoration: none;
  text-shadow: none;
  text-transform: none;
  white-space: normal;
  word-break: normal;
  word-spacing: normal;
  word-wrap: normal;
  font-size: 13px;
  background-color: #fff;
  background-clip: padding-box;
  border: 1px solid #ccc;
  border: 1px solid rgba(0, 0, 0, 0.2);
  border-radius: 3px;
  -webkit-box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);
  box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);
}
.popover.top {
  margin-top: -10px;
}
.popover.right {
  margin-left: 10px;
}
.popover.bottom {
  margin-top: 10px;
}
.popover.left {
  margin-left: -10px;
}
.popover-title {
  margin: 0;
  padding: 8px 14px;
  font-size: 13px;
  background-color: #f7f7f7;
  border-bottom: 1px solid #ebebeb;
  border-radius: 2px 2px 0 0;
}
.popover-content {
  padding: 9px 14px;
}
.popover > .arrow,
.popover > .arrow:after {
  position: absolute;
  display: block;
  width: 0;
  height: 0;
  border-color: transparent;
  border-style: solid;
}
.popover > .arrow {
  border-width: 11px;
}
.popover > .arrow:after {
  border-width: 10px;
  content: "";
}
.popover.top > .arrow {
  left: 50%;
  margin-left: -11px;
  border-bottom-width: 0;
  border-top-color: #999999;
  border-top-color: rgba(0, 0, 0, 0.25);
  bottom: -11px;
}
.popover.top > .arrow:after {
  content: " ";
  bottom: 1px;
  margin-left: -10px;
  border-bottom-width: 0;
  border-top-color: #fff;
}
.popover.right > .arrow {
  top: 50%;
  left: -11px;
  margin-top: -11px;
  border-left-width: 0;
  border-right-color: #999999;
  border-right-color: rgba(0, 0, 0, 0.25);
}
.popover.right > .arrow:after {
  content: " ";
  left: 1px;
  bottom: -10px;
  border-left-width: 0;
  border-right-color: #fff;
}
.popover.bottom > .arrow {
  left: 50%;
  margin-left: -11px;
  border-top-width: 0;
  border-bottom-color: #999999;
  border-bottom-color: rgba(0, 0, 0, 0.25);
  top: -11px;
}
.popover.bottom > .arrow:after {
  content: " ";
  top: 1px;
  margin-left: -10px;
  border-top-width: 0;
  border-bottom-color: #fff;
}
.popover.left > .arrow {
  top: 50%;
  right: -11px;
  margin-top: -11px;
  border-right-width: 0;
  border-left-color: #999999;
  border-left-color: rgba(0, 0, 0, 0.25);
}
.popover.left > .arrow:after {
  content: " ";
  right: 1px;
  border-right-width: 0;
  border-left-color: #fff;
  bottom: -10px;
}
.carousel {
  position: relative;
}
.carousel-inner {
  position: relative;
  overflow: hidden;
  width: 100%;
}
.carousel-inner > .item {
  display: none;
  position: relative;
  -webkit-transition: 0.6s ease-in-out left;
  -o-transition: 0.6s ease-in-out left;
  transition: 0.6s ease-in-out left;
}
.carousel-inner > .item > img,
.carousel-inner > .item > a > img {
  line-height: 1;
}
@media all and (transform-3d), (-webkit-transform-3d) {
  .carousel-inner > .item {
    -webkit-transition: -webkit-transform 0.6s ease-in-out;
    -moz-transition: -moz-transform 0.6s ease-in-out;
    -o-transition: -o-transform 0.6s ease-in-out;
    transition: transform 0.6s ease-in-out;
    -webkit-backface-visibility: hidden;
    -moz-backface-visibility: hidden;
    backface-visibility: hidden;
    -webkit-perspective: 1000px;
    -moz-perspective: 1000px;
    perspective: 1000px;
  }
  .carousel-inner > .item.next,
  .carousel-inner > .item.active.right {
    -webkit-transform: translate3d(100%, 0, 0);
    transform: translate3d(100%, 0, 0);
    left: 0;
  }
  .carousel-inner > .item.prev,
  .carousel-inner > .item.active.left {
    -webkit-transform: translate3d(-100%, 0, 0);
    transform: translate3d(-100%, 0, 0);
    left: 0;
  }
  .carousel-inner > .item.next.left,
  .carousel-inner > .item.prev.right,
  .carousel-inner > .item.active {
    -webkit-transform: translate3d(0, 0, 0);
    transform: translate3d(0, 0, 0);
    left: 0;
  }
}
.carousel-inner > .active,
.carousel-inner > .next,
.carousel-inner > .prev {
  display: block;
}
.carousel-inner > .active {
  left: 0;
}
.carousel-inner > .next,
.carousel-inner > .prev {
  position: absolute;
  top: 0;
  width: 100%;
}
.carousel-inner > .next {
  left: 100%;
}
.carousel-inner > .prev {
  left: -100%;
}
.carousel-inner > .next.left,
.carousel-inner > .prev.right {
  left: 0;
}
.carousel-inner > .active.left {
  left: -100%;
}
.carousel-inner > .active.right {
  left: 100%;
}
.carousel-control {
  position: absolute;
  top: 0;
  left: 0;
  bottom: 0;
  width: 15%;
  opacity: 0.5;
  filter: alpha(opacity=50);
  font-size: 20px;
  color: #fff;
  text-align: center;
  text-shadow: 0 1px 2px rgba(0, 0, 0, 0.6);
  background-color: rgba(0, 0, 0, 0);
}
.carousel-control.left {
  background-image: -webkit-linear-gradient(left, rgba(0, 0, 0, 0.5) 0%, rgba(0, 0, 0, 0.0001) 100%);
  background-image: -o-linear-gradient(left, rgba(0, 0, 0, 0.5) 0%, rgba(0, 0, 0, 0.0001) 100%);
  background-image: linear-gradient(to right, rgba(0, 0, 0, 0.5) 0%, rgba(0, 0, 0, 0.0001) 100%);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#80000000', endColorstr='#00000000', GradientType=1);
}
.carousel-control.right {
  left: auto;
  right: 0;
  background-image: -webkit-linear-gradient(left, rgba(0, 0, 0, 0.0001) 0%, rgba(0, 0, 0, 0.5) 100%);
  background-image: -o-linear-gradient(left, rgba(0, 0, 0, 0.0001) 0%, rgba(0, 0, 0, 0.5) 100%);
  background-image: linear-gradient(to right, rgba(0, 0, 0, 0.0001) 0%, rgba(0, 0, 0, 0.5) 100%);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#00000000', endColorstr='#80000000', GradientType=1);
}
.carousel-control:hover,
.carousel-control:focus {
  outline: 0;
  color: #fff;
  text-decoration: none;
  opacity: 0.9;
  filter: alpha(opacity=90);
}
.carousel-control .icon-prev,
.carousel-control .icon-next,
.carousel-control .glyphicon-chevron-left,
.carousel-control .glyphicon-chevron-right {
  position: absolute;
  top: 50%;
  margin-top: -10px;
  z-index: 5;
  display: inline-block;
}
.carousel-control .icon-prev,
.carousel-control .glyphicon-chevron-left {
  left: 50%;
  margin-left: -10px;
}
.carousel-control .icon-next,
.carousel-control .glyphicon-chevron-right {
  right: 50%;
  margin-right: -10px;
}
.carousel-control .icon-prev,
.carousel-control .icon-next {
  width: 20px;
  height: 20px;
  line-height: 1;
  font-family: serif;
}
.carousel-control .icon-prev:before {
  content: '\2039';
}
.carousel-control .icon-next:before {
  content: '\203a';
}
.carousel-indicators {
  position: absolute;
  bottom: 10px;
  left: 50%;
  z-index: 15;
  width: 60%;
  margin-left: -30%;
  padding-left: 0;
  list-style: none;
  text-align: center;
}
.carousel-indicators li {
  display: inline-block;
  width: 10px;
  height: 10px;
  margin: 1px;
  text-indent: -999px;
  border: 1px solid #fff;
  border-radius: 10px;
  cursor: pointer;
  background-color: #000 \9;
  background-color: rgba(0, 0, 0, 0);
}
.carousel-indicators .active {
  margin: 0;
  width: 12px;
  height: 12px;
  background-color: #fff;
}
.carousel-caption {
  position: absolute;
  left: 15%;
  right: 15%;
  bottom: 20px;
  z-index: 10;
  padding-top: 20px;
  padding-bottom: 20px;
  color: #fff;
  text-align: center;
  text-shadow: 0 1px 2px rgba(0, 0, 0, 0.6);
}
.carousel-caption .btn {
  text-shadow: none;
}
@media screen and (min-width: 768px) {
  .carousel-control .glyphicon-chevron-left,
  .carousel-control .glyphicon-chevron-right,
  .carousel-control .icon-prev,
  .carousel-control .icon-next {
    width: 30px;
    height: 30px;
    margin-top: -10px;
    font-size: 30px;
  }
  .carousel-control .glyphicon-chevron-left,
  .carousel-control .icon-prev {
    margin-left: -10px;
  }
  .carousel-control .glyphicon-chevron-right,
  .carousel-control .icon-next {
    margin-right: -10px;
  }
  .carousel-caption {
    left: 20%;
    right: 20%;
    padding-bottom: 30px;
  }
  .carousel-indicators {
    bottom: 20px;
  }
}
.clearfix:before,
.clearfix:after,
.dl-horizontal dd:before,
.dl-horizontal dd:after,
.container:before,
.container:after,
.container-fluid:before,
.container-fluid:after,
.row:before,
.row:after,
.form-horizontal .form-group:before,
.form-horizontal .form-group:after,
.btn-toolbar:before,
.btn-toolbar:after,
.btn-group-vertical > .btn-group:before,
.btn-group-vertical > .btn-group:after,
.nav:before,
.nav:after,
.navbar:before,
.navbar:after,
.navbar-header:before,
.navbar-header:after,
.navbar-collapse:before,
.navbar-collapse:after,
.pager:before,
.pager:after,
.panel-body:before,
.panel-body:after,
.modal-header:before,
.modal-header:after,
.modal-footer:before,
.modal-footer:after,
.item_buttons:before,
.item_buttons:after {
  content: " ";
  display: table;
}
.clearfix:after,
.dl-horizontal dd:after,
.container:after,
.container-fluid:after,
.row:after,
.form-horizontal .form-group:after,
.btn-toolbar:after,
.btn-group-vertical > .btn-group:after,
.nav:after,
.navbar:after,
.navbar-header:after,
.navbar-collapse:after,
.pager:after,
.panel-body:after,
.modal-header:after,
.modal-footer:after,
.item_buttons:after {
  clear: both;
}
.center-block {
  display: block;
  margin-left: auto;
  margin-right: auto;
}
.pull-right {
  float: right !important;
}
.pull-left {
  float: left !important;
}
.hide {
  display: none !important;
}
.show {
  display: block !important;
}
.invisible {
  visibility: hidden;
}
.text-hide {
  font: 0/0 a;
  color: transparent;
  text-shadow: none;
  background-color: transparent;
  border: 0;
}
.hidden {
  display: none !important;
}
.affix {
  position: fixed;
}
@-ms-viewport {
  width: device-width;
}
.visible-xs,
.visible-sm,
.visible-md,
.visible-lg {
  display: none !important;
}
.visible-xs-block,
.visible-xs-inline,
.visible-xs-inline-block,
.visible-sm-block,
.visible-sm-inline,
.visible-sm-inline-block,
.visible-md-block,
.visible-md-inline,
.visible-md-inline-block,
.visible-lg-block,
.visible-lg-inline,
.visible-lg-inline-block {
  display: none !important;
}
@media (max-width: 767px) {
  .visible-xs {
    display: block !important;
  }
  table.visible-xs {
    display: table !important;
  }
  tr.visible-xs {
    display: table-row !important;
  }
  th.visible-xs,
  td.visible-xs {
    display: table-cell !important;
  }
}
@media (max-width: 767px) {
  .visible-xs-block {
    display: block !important;
  }
}
@media (max-width: 767px) {
  .visible-xs-inline {
    display: inline !important;
  }
}
@media (max-width: 767px) {
  .visible-xs-inline-block {
    display: inline-block !important;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  .visible-sm {
    display: block !important;
  }
  table.visible-sm {
    display: table !important;
  }
  tr.visible-sm {
    display: table-row !important;
  }
  th.visible-sm,
  td.visible-sm {
    display: table-cell !important;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  .visible-sm-block {
    display: block !important;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  .visible-sm-inline {
    display: inline !important;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  .visible-sm-inline-block {
    display: inline-block !important;
  }
}
@media (min-width: 992px) and (max-width: 1199px) {
  .visible-md {
    display: block !important;
  }
  table.visible-md {
    display: table !important;
  }
  tr.visible-md {
    display: table-row !important;
  }
  th.visible-md,
  td.visible-md {
    display: table-cell !important;
  }
}
@media (min-width: 992px) and (max-width: 1199px) {
  .visible-md-block {
    display: block !important;
  }
}
@media (min-width: 992px) and (max-width: 1199px) {
  .visible-md-inline {
    display: inline !important;
  }
}
@media (min-width: 992px) and (max-width: 1199px) {
  .visible-md-inline-block {
    display: inline-block !important;
  }
}
@media (min-width: 1200px) {
  .visible-lg {
    display: block !important;
  }
  table.visible-lg {
    display: table !important;
  }
  tr.visible-lg {
    display: table-row !important;
  }
  th.visible-lg,
  td.visible-lg {
    display: table-cell !important;
  }
}
@media (min-width: 1200px) {
  .visible-lg-block {
    display: block !important;
  }
}
@media (min-width: 1200px) {
  .visible-lg-inline {
    display: inline !important;
  }
}
@media (min-width: 1200px) {
  .visible-lg-inline-block {
    display: inline-block !important;
  }
}
@media (max-width: 767px) {
  .hidden-xs {
    display: none !important;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  .hidden-sm {
    display: none !important;
  }
}
@media (min-width: 992px) and (max-width: 1199px) {
  .hidden-md {
    display: none !important;
  }
}
@media (min-width: 1200px) {
  .hidden-lg {
    display: none !important;
  }
}
.visible-print {
  display: none !important;
}
@media print {
  .visible-print {
    display: block !important;
  }
  table.visible-print {
    display: table !important;
  }
  tr.visible-print {
    display: table-row !important;
  }
  th.visible-print,
  td.visible-print {
    display: table-cell !important;
  }
}
.visible-print-block {
  display: none !important;
}
@media print {
  .visible-print-block {
    display: block !important;
  }
}
.visible-print-inline {
  display: none !important;
}
@media print {
  .visible-print-inline {
    display: inline !important;
  }
}
.visible-print-inline-block {
  display: none !important;
}
@media print {
  .visible-print-inline-block {
    display: inline-block !important;
  }
}
@media print {
  .hidden-print {
    display: none !important;
  }
}
/*!
*
* Font Awesome
*
*/
/*!
 *  Font Awesome 4.7.0 by @davegandy - http://fontawesome.io - @fontawesome
 *  License - http://fontawesome.io/license (Font: SIL OFL 1.1, CSS: MIT License)
 */
/* FONT PATH
 * -------------------------- */
@font-face {
  font-family: 'FontAwesome';
  src: url('../components/font-awesome/fonts/fontawesome-webfont.eot?v=4.7.0');
  src: url('../components/font-awesome/fonts/fontawesome-webfont.eot?#iefix&v=4.7.0') format('embedded-opentype'), url('../components/font-awesome/fonts/fontawesome-webfont.woff2?v=4.7.0') format('woff2'), url('../components/font-awesome/fonts/fontawesome-webfont.woff?v=4.7.0') format('woff'), url('../components/font-awesome/fonts/fontawesome-webfont.ttf?v=4.7.0') format('truetype'), url('../components/font-awesome/fonts/fontawesome-webfont.svg?v=4.7.0#fontawesomeregular') format('svg');
  font-weight: normal;
  font-style: normal;
}
.fa {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
}
/* makes the font 33% larger relative to the icon container */
.fa-lg {
  font-size: 1.33333333em;
  line-height: 0.75em;
  vertical-align: -15%;
}
.fa-2x {
  font-size: 2em;
}
.fa-3x {
  font-size: 3em;
}
.fa-4x {
  font-size: 4em;
}
.fa-5x {
  font-size: 5em;
}
.fa-fw {
  width: 1.28571429em;
  text-align: center;
}
.fa-ul {
  padding-left: 0;
  margin-left: 2.14285714em;
  list-style-type: none;
}
.fa-ul > li {
  position: relative;
}
.fa-li {
  position: absolute;
  left: -2.14285714em;
  width: 2.14285714em;
  top: 0.14285714em;
  text-align: center;
}
.fa-li.fa-lg {
  left: -1.85714286em;
}
.fa-border {
  padding: .2em .25em .15em;
  border: solid 0.08em #eee;
  border-radius: .1em;
}
.fa-pull-left {
  float: left;
}
.fa-pull-right {
  float: right;
}
.fa.fa-pull-left {
  margin-right: .3em;
}
.fa.fa-pull-right {
  margin-left: .3em;
}
/* Deprecated as of 4.4.0 */
.pull-right {
  float: right;
}
.pull-left {
  float: left;
}
.fa.pull-left {
  margin-right: .3em;
}
.fa.pull-right {
  margin-left: .3em;
}
.fa-spin {
  -webkit-animation: fa-spin 2s infinite linear;
  animation: fa-spin 2s infinite linear;
}
.fa-pulse {
  -webkit-animation: fa-spin 1s infinite steps(8);
  animation: fa-spin 1s infinite steps(8);
}
@-webkit-keyframes fa-spin {
  0% {
    -webkit-transform: rotate(0deg);
    transform: rotate(0deg);
  }
  100% {
    -webkit-transform: rotate(359deg);
    transform: rotate(359deg);
  }
}
@keyframes fa-spin {
  0% {
    -webkit-transform: rotate(0deg);
    transform: rotate(0deg);
  }
  100% {
    -webkit-transform: rotate(359deg);
    transform: rotate(359deg);
  }
}
.fa-rotate-90 {
  -ms-filter: "progid:DXImageTransform.Microsoft.BasicImage(rotation=1)";
  -webkit-transform: rotate(90deg);
  -ms-transform: rotate(90deg);
  transform: rotate(90deg);
}
.fa-rotate-180 {
  -ms-filter: "progid:DXImageTransform.Microsoft.BasicImage(rotation=2)";
  -webkit-transform: rotate(180deg);
  -ms-transform: rotate(180deg);
  transform: rotate(180deg);
}
.fa-rotate-270 {
  -ms-filter: "progid:DXImageTransform.Microsoft.BasicImage(rotation=3)";
  -webkit-transform: rotate(270deg);
  -ms-transform: rotate(270deg);
  transform: rotate(270deg);
}
.fa-flip-horizontal {
  -ms-filter: "progid:DXImageTransform.Microsoft.BasicImage(rotation=0, mirror=1)";
  -webkit-transform: scale(-1, 1);
  -ms-transform: scale(-1, 1);
  transform: scale(-1, 1);
}
.fa-flip-vertical {
  -ms-filter: "progid:DXImageTransform.Microsoft.BasicImage(rotation=2, mirror=1)";
  -webkit-transform: scale(1, -1);
  -ms-transform: scale(1, -1);
  transform: scale(1, -1);
}
:root .fa-rotate-90,
:root .fa-rotate-180,
:root .fa-rotate-270,
:root .fa-flip-horizontal,
:root .fa-flip-vertical {
  filter: none;
}
.fa-stack {
  position: relative;
  display: inline-block;
  width: 2em;
  height: 2em;
  line-height: 2em;
  vertical-align: middle;
}
.fa-stack-1x,
.fa-stack-2x {
  position: absolute;
  left: 0;
  width: 100%;
  text-align: center;
}
.fa-stack-1x {
  line-height: inherit;
}
.fa-stack-2x {
  font-size: 2em;
}
.fa-inverse {
  color: #fff;
}
/* Font Awesome uses the Unicode Private Use Area (PUA) to ensure screen
   readers do not read off random characters that represent icons */
.fa-glass:before {
  content: "\f000";
}
.fa-music:before {
  content: "\f001";
}
.fa-search:before {
  content: "\f002";
}
.fa-envelope-o:before {
  content: "\f003";
}
.fa-heart:before {
  content: "\f004";
}
.fa-star:before {
  content: "\f005";
}
.fa-star-o:before {
  content: "\f006";
}
.fa-user:before {
  content: "\f007";
}
.fa-film:before {
  content: "\f008";
}
.fa-th-large:before {
  content: "\f009";
}
.fa-th:before {
  content: "\f00a";
}
.fa-th-list:before {
  content: "\f00b";
}
.fa-check:before {
  content: "\f00c";
}
.fa-remove:before,
.fa-close:before,
.fa-times:before {
  content: "\f00d";
}
.fa-search-plus:before {
  content: "\f00e";
}
.fa-search-minus:before {
  content: "\f010";
}
.fa-power-off:before {
  content: "\f011";
}
.fa-signal:before {
  content: "\f012";
}
.fa-gear:before,
.fa-cog:before {
  content: "\f013";
}
.fa-trash-o:before {
  content: "\f014";
}
.fa-home:before {
  content: "\f015";
}
.fa-file-o:before {
  content: "\f016";
}
.fa-clock-o:before {
  content: "\f017";
}
.fa-road:before {
  content: "\f018";
}
.fa-download:before {
  content: "\f019";
}
.fa-arrow-circle-o-down:before {
  content: "\f01a";
}
.fa-arrow-circle-o-up:before {
  content: "\f01b";
}
.fa-inbox:before {
  content: "\f01c";
}
.fa-play-circle-o:before {
  content: "\f01d";
}
.fa-rotate-right:before,
.fa-repeat:before {
  content: "\f01e";
}
.fa-refresh:before {
  content: "\f021";
}
.fa-list-alt:before {
  content: "\f022";
}
.fa-lock:before {
  content: "\f023";
}
.fa-flag:before {
  content: "\f024";
}
.fa-headphones:before {
  content: "\f025";
}
.fa-volume-off:before {
  content: "\f026";
}
.fa-volume-down:before {
  content: "\f027";
}
.fa-volume-up:before {
  content: "\f028";
}
.fa-qrcode:before {
  content: "\f029";
}
.fa-barcode:before {
  content: "\f02a";
}
.fa-tag:before {
  content: "\f02b";
}
.fa-tags:before {
  content: "\f02c";
}
.fa-book:before {
  content: "\f02d";
}
.fa-bookmark:before {
  content: "\f02e";
}
.fa-print:before {
  content: "\f02f";
}
.fa-camera:before {
  content: "\f030";
}
.fa-font:before {
  content: "\f031";
}
.fa-bold:before {
  content: "\f032";
}
.fa-italic:before {
  content: "\f033";
}
.fa-text-height:before {
  content: "\f034";
}
.fa-text-width:before {
  content: "\f035";
}
.fa-align-left:before {
  content: "\f036";
}
.fa-align-center:before {
  content: "\f037";
}
.fa-align-right:before {
  content: "\f038";
}
.fa-align-justify:before {
  content: "\f039";
}
.fa-list:before {
  content: "\f03a";
}
.fa-dedent:before,
.fa-outdent:before {
  content: "\f03b";
}
.fa-indent:before {
  content: "\f03c";
}
.fa-video-camera:before {
  content: "\f03d";
}
.fa-photo:before,
.fa-image:before,
.fa-picture-o:before {
  content: "\f03e";
}
.fa-pencil:before {
  content: "\f040";
}
.fa-map-marker:before {
  content: "\f041";
}
.fa-adjust:before {
  content: "\f042";
}
.fa-tint:before {
  content: "\f043";
}
.fa-edit:before,
.fa-pencil-square-o:before {
  content: "\f044";
}
.fa-share-square-o:before {
  content: "\f045";
}
.fa-check-square-o:before {
  content: "\f046";
}
.fa-arrows:before {
  content: "\f047";
}
.fa-step-backward:before {
  content: "\f048";
}
.fa-fast-backward:before {
  content: "\f049";
}
.fa-backward:before {
  content: "\f04a";
}
.fa-play:before {
  content: "\f04b";
}
.fa-pause:before {
  content: "\f04c";
}
.fa-stop:before {
  content: "\f04d";
}
.fa-forward:before {
  content: "\f04e";
}
.fa-fast-forward:before {
  content: "\f050";
}
.fa-step-forward:before {
  content: "\f051";
}
.fa-eject:before {
  content: "\f052";
}
.fa-chevron-left:before {
  content: "\f053";
}
.fa-chevron-right:before {
  content: "\f054";
}
.fa-plus-circle:before {
  content: "\f055";
}
.fa-minus-circle:before {
  content: "\f056";
}
.fa-times-circle:before {
  content: "\f057";
}
.fa-check-circle:before {
  content: "\f058";
}
.fa-question-circle:before {
  content: "\f059";
}
.fa-info-circle:before {
  content: "\f05a";
}
.fa-crosshairs:before {
  content: "\f05b";
}
.fa-times-circle-o:before {
  content: "\f05c";
}
.fa-check-circle-o:before {
  content: "\f05d";
}
.fa-ban:before {
  content: "\f05e";
}
.fa-arrow-left:before {
  content: "\f060";
}
.fa-arrow-right:before {
  content: "\f061";
}
.fa-arrow-up:before {
  content: "\f062";
}
.fa-arrow-down:before {
  content: "\f063";
}
.fa-mail-forward:before,
.fa-share:before {
  content: "\f064";
}
.fa-expand:before {
  content: "\f065";
}
.fa-compress:before {
  content: "\f066";
}
.fa-plus:before {
  content: "\f067";
}
.fa-minus:before {
  content: "\f068";
}
.fa-asterisk:before {
  content: "\f069";
}
.fa-exclamation-circle:before {
  content: "\f06a";
}
.fa-gift:before {
  content: "\f06b";
}
.fa-leaf:before {
  content: "\f06c";
}
.fa-fire:before {
  content: "\f06d";
}
.fa-eye:before {
  content: "\f06e";
}
.fa-eye-slash:before {
  content: "\f070";
}
.fa-warning:before,
.fa-exclamation-triangle:before {
  content: "\f071";
}
.fa-plane:before {
  content: "\f072";
}
.fa-calendar:before {
  content: "\f073";
}
.fa-random:before {
  content: "\f074";
}
.fa-comment:before {
  content: "\f075";
}
.fa-magnet:before {
  content: "\f076";
}
.fa-chevron-up:before {
  content: "\f077";
}
.fa-chevron-down:before {
  content: "\f078";
}
.fa-retweet:before {
  content: "\f079";
}
.fa-shopping-cart:before {
  content: "\f07a";
}
.fa-folder:before {
  content: "\f07b";
}
.fa-folder-open:before {
  content: "\f07c";
}
.fa-arrows-v:before {
  content: "\f07d";
}
.fa-arrows-h:before {
  content: "\f07e";
}
.fa-bar-chart-o:before,
.fa-bar-chart:before {
  content: "\f080";
}
.fa-twitter-square:before {
  content: "\f081";
}
.fa-facebook-square:before {
  content: "\f082";
}
.fa-camera-retro:before {
  content: "\f083";
}
.fa-key:before {
  content: "\f084";
}
.fa-gears:before,
.fa-cogs:before {
  content: "\f085";
}
.fa-comments:before {
  content: "\f086";
}
.fa-thumbs-o-up:before {
  content: "\f087";
}
.fa-thumbs-o-down:before {
  content: "\f088";
}
.fa-star-half:before {
  content: "\f089";
}
.fa-heart-o:before {
  content: "\f08a";
}
.fa-sign-out:before {
  content: "\f08b";
}
.fa-linkedin-square:before {
  content: "\f08c";
}
.fa-thumb-tack:before {
  content: "\f08d";
}
.fa-external-link:before {
  content: "\f08e";
}
.fa-sign-in:before {
  content: "\f090";
}
.fa-trophy:before {
  content: "\f091";
}
.fa-github-square:before {
  content: "\f092";
}
.fa-upload:before {
  content: "\f093";
}
.fa-lemon-o:before {
  content: "\f094";
}
.fa-phone:before {
  content: "\f095";
}
.fa-square-o:before {
  content: "\f096";
}
.fa-bookmark-o:before {
  content: "\f097";
}
.fa-phone-square:before {
  content: "\f098";
}
.fa-twitter:before {
  content: "\f099";
}
.fa-facebook-f:before,
.fa-facebook:before {
  content: "\f09a";
}
.fa-github:before {
  content: "\f09b";
}
.fa-unlock:before {
  content: "\f09c";
}
.fa-credit-card:before {
  content: "\f09d";
}
.fa-feed:before,
.fa-rss:before {
  content: "\f09e";
}
.fa-hdd-o:before {
  content: "\f0a0";
}
.fa-bullhorn:before {
  content: "\f0a1";
}
.fa-bell:before {
  content: "\f0f3";
}
.fa-certificate:before {
  content: "\f0a3";
}
.fa-hand-o-right:before {
  content: "\f0a4";
}
.fa-hand-o-left:before {
  content: "\f0a5";
}
.fa-hand-o-up:before {
  content: "\f0a6";
}
.fa-hand-o-down:before {
  content: "\f0a7";
}
.fa-arrow-circle-left:before {
  content: "\f0a8";
}
.fa-arrow-circle-right:before {
  content: "\f0a9";
}
.fa-arrow-circle-up:before {
  content: "\f0aa";
}
.fa-arrow-circle-down:before {
  content: "\f0ab";
}
.fa-globe:before {
  content: "\f0ac";
}
.fa-wrench:before {
  content: "\f0ad";
}
.fa-tasks:before {
  content: "\f0ae";
}
.fa-filter:before {
  content: "\f0b0";
}
.fa-briefcase:before {
  content: "\f0b1";
}
.fa-arrows-alt:before {
  content: "\f0b2";
}
.fa-group:before,
.fa-users:before {
  content: "\f0c0";
}
.fa-chain:before,
.fa-link:before {
  content: "\f0c1";
}
.fa-cloud:before {
  content: "\f0c2";
}
.fa-flask:before {
  content: "\f0c3";
}
.fa-cut:before,
.fa-scissors:before {
  content: "\f0c4";
}
.fa-copy:before,
.fa-files-o:before {
  content: "\f0c5";
}
.fa-paperclip:before {
  content: "\f0c6";
}
.fa-save:before,
.fa-floppy-o:before {
  content: "\f0c7";
}
.fa-square:before {
  content: "\f0c8";
}
.fa-navicon:before,
.fa-reorder:before,
.fa-bars:before {
  content: "\f0c9";
}
.fa-list-ul:before {
  content: "\f0ca";
}
.fa-list-ol:before {
  content: "\f0cb";
}
.fa-strikethrough:before {
  content: "\f0cc";
}
.fa-underline:before {
  content: "\f0cd";
}
.fa-table:before {
  content: "\f0ce";
}
.fa-magic:before {
  content: "\f0d0";
}
.fa-truck:before {
  content: "\f0d1";
}
.fa-pinterest:before {
  content: "\f0d2";
}
.fa-pinterest-square:before {
  content: "\f0d3";
}
.fa-google-plus-square:before {
  content: "\f0d4";
}
.fa-google-plus:before {
  content: "\f0d5";
}
.fa-money:before {
  content: "\f0d6";
}
.fa-caret-down:before {
  content: "\f0d7";
}
.fa-caret-up:before {
  content: "\f0d8";
}
.fa-caret-left:before {
  content: "\f0d9";
}
.fa-caret-right:before {
  content: "\f0da";
}
.fa-columns:before {
  content: "\f0db";
}
.fa-unsorted:before,
.fa-sort:before {
  content: "\f0dc";
}
.fa-sort-down:before,
.fa-sort-desc:before {
  content: "\f0dd";
}
.fa-sort-up:before,
.fa-sort-asc:before {
  content: "\f0de";
}
.fa-envelope:before {
  content: "\f0e0";
}
.fa-linkedin:before {
  content: "\f0e1";
}
.fa-rotate-left:before,
.fa-undo:before {
  content: "\f0e2";
}
.fa-legal:before,
.fa-gavel:before {
  content: "\f0e3";
}
.fa-dashboard:before,
.fa-tachometer:before {
  content: "\f0e4";
}
.fa-comment-o:before {
  content: "\f0e5";
}
.fa-comments-o:before {
  content: "\f0e6";
}
.fa-flash:before,
.fa-bolt:before {
  content: "\f0e7";
}
.fa-sitemap:before {
  content: "\f0e8";
}
.fa-umbrella:before {
  content: "\f0e9";
}
.fa-paste:before,
.fa-clipboard:before {
  content: "\f0ea";
}
.fa-lightbulb-o:before {
  content: "\f0eb";
}
.fa-exchange:before {
  content: "\f0ec";
}
.fa-cloud-download:before {
  content: "\f0ed";
}
.fa-cloud-upload:before {
  content: "\f0ee";
}
.fa-user-md:before {
  content: "\f0f0";
}
.fa-stethoscope:before {
  content: "\f0f1";
}
.fa-suitcase:before {
  content: "\f0f2";
}
.fa-bell-o:before {
  content: "\f0a2";
}
.fa-coffee:before {
  content: "\f0f4";
}
.fa-cutlery:before {
  content: "\f0f5";
}
.fa-file-text-o:before {
  content: "\f0f6";
}
.fa-building-o:before {
  content: "\f0f7";
}
.fa-hospital-o:before {
  content: "\f0f8";
}
.fa-ambulance:before {
  content: "\f0f9";
}
.fa-medkit:before {
  content: "\f0fa";
}
.fa-fighter-jet:before {
  content: "\f0fb";
}
.fa-beer:before {
  content: "\f0fc";
}
.fa-h-square:before {
  content: "\f0fd";
}
.fa-plus-square:before {
  content: "\f0fe";
}
.fa-angle-double-left:before {
  content: "\f100";
}
.fa-angle-double-right:before {
  content: "\f101";
}
.fa-angle-double-up:before {
  content: "\f102";
}
.fa-angle-double-down:before {
  content: "\f103";
}
.fa-angle-left:before {
  content: "\f104";
}
.fa-angle-right:before {
  content: "\f105";
}
.fa-angle-up:before {
  content: "\f106";
}
.fa-angle-down:before {
  content: "\f107";
}
.fa-desktop:before {
  content: "\f108";
}
.fa-laptop:before {
  content: "\f109";
}
.fa-tablet:before {
  content: "\f10a";
}
.fa-mobile-phone:before,
.fa-mobile:before {
  content: "\f10b";
}
.fa-circle-o:before {
  content: "\f10c";
}
.fa-quote-left:before {
  content: "\f10d";
}
.fa-quote-right:before {
  content: "\f10e";
}
.fa-spinner:before {
  content: "\f110";
}
.fa-circle:before {
  content: "\f111";
}
.fa-mail-reply:before,
.fa-reply:before {
  content: "\f112";
}
.fa-github-alt:before {
  content: "\f113";
}
.fa-folder-o:before {
  content: "\f114";
}
.fa-folder-open-o:before {
  content: "\f115";
}
.fa-smile-o:before {
  content: "\f118";
}
.fa-frown-o:before {
  content: "\f119";
}
.fa-meh-o:before {
  content: "\f11a";
}
.fa-gamepad:before {
  content: "\f11b";
}
.fa-keyboard-o:before {
  content: "\f11c";
}
.fa-flag-o:before {
  content: "\f11d";
}
.fa-flag-checkered:before {
  content: "\f11e";
}
.fa-terminal:before {
  content: "\f120";
}
.fa-code:before {
  content: "\f121";
}
.fa-mail-reply-all:before,
.fa-reply-all:before {
  content: "\f122";
}
.fa-star-half-empty:before,
.fa-star-half-full:before,
.fa-star-half-o:before {
  content: "\f123";
}
.fa-location-arrow:before {
  content: "\f124";
}
.fa-crop:before {
  content: "\f125";
}
.fa-code-fork:before {
  content: "\f126";
}
.fa-unlink:before,
.fa-chain-broken:before {
  content: "\f127";
}
.fa-question:before {
  content: "\f128";
}
.fa-info:before {
  content: "\f129";
}
.fa-exclamation:before {
  content: "\f12a";
}
.fa-superscript:before {
  content: "\f12b";
}
.fa-subscript:before {
  content: "\f12c";
}
.fa-eraser:before {
  content: "\f12d";
}
.fa-puzzle-piece:before {
  content: "\f12e";
}
.fa-microphone:before {
  content: "\f130";
}
.fa-microphone-slash:before {
  content: "\f131";
}
.fa-shield:before {
  content: "\f132";
}
.fa-calendar-o:before {
  content: "\f133";
}
.fa-fire-extinguisher:before {
  content: "\f134";
}
.fa-rocket:before {
  content: "\f135";
}
.fa-maxcdn:before {
  content: "\f136";
}
.fa-chevron-circle-left:before {
  content: "\f137";
}
.fa-chevron-circle-right:before {
  content: "\f138";
}
.fa-chevron-circle-up:before {
  content: "\f139";
}
.fa-chevron-circle-down:before {
  content: "\f13a";
}
.fa-html5:before {
  content: "\f13b";
}
.fa-css3:before {
  content: "\f13c";
}
.fa-anchor:before {
  content: "\f13d";
}
.fa-unlock-alt:before {
  content: "\f13e";
}
.fa-bullseye:before {
  content: "\f140";
}
.fa-ellipsis-h:before {
  content: "\f141";
}
.fa-ellipsis-v:before {
  content: "\f142";
}
.fa-rss-square:before {
  content: "\f143";
}
.fa-play-circle:before {
  content: "\f144";
}
.fa-ticket:before {
  content: "\f145";
}
.fa-minus-square:before {
  content: "\f146";
}
.fa-minus-square-o:before {
  content: "\f147";
}
.fa-level-up:before {
  content: "\f148";
}
.fa-level-down:before {
  content: "\f149";
}
.fa-check-square:before {
  content: "\f14a";
}
.fa-pencil-square:before {
  content: "\f14b";
}
.fa-external-link-square:before {
  content: "\f14c";
}
.fa-share-square:before {
  content: "\f14d";
}
.fa-compass:before {
  content: "\f14e";
}
.fa-toggle-down:before,
.fa-caret-square-o-down:before {
  content: "\f150";
}
.fa-toggle-up:before,
.fa-caret-square-o-up:before {
  content: "\f151";
}
.fa-toggle-right:before,
.fa-caret-square-o-right:before {
  content: "\f152";
}
.fa-euro:before,
.fa-eur:before {
  content: "\f153";
}
.fa-gbp:before {
  content: "\f154";
}
.fa-dollar:before,
.fa-usd:before {
  content: "\f155";
}
.fa-rupee:before,
.fa-inr:before {
  content: "\f156";
}
.fa-cny:before,
.fa-rmb:before,
.fa-yen:before,
.fa-jpy:before {
  content: "\f157";
}
.fa-ruble:before,
.fa-rouble:before,
.fa-rub:before {
  content: "\f158";
}
.fa-won:before,
.fa-krw:before {
  content: "\f159";
}
.fa-bitcoin:before,
.fa-btc:before {
  content: "\f15a";
}
.fa-file:before {
  content: "\f15b";
}
.fa-file-text:before {
  content: "\f15c";
}
.fa-sort-alpha-asc:before {
  content: "\f15d";
}
.fa-sort-alpha-desc:before {
  content: "\f15e";
}
.fa-sort-amount-asc:before {
  content: "\f160";
}
.fa-sort-amount-desc:before {
  content: "\f161";
}
.fa-sort-numeric-asc:before {
  content: "\f162";
}
.fa-sort-numeric-desc:before {
  content: "\f163";
}
.fa-thumbs-up:before {
  content: "\f164";
}
.fa-thumbs-down:before {
  content: "\f165";
}
.fa-youtube-square:before {
  content: "\f166";
}
.fa-youtube:before {
  content: "\f167";
}
.fa-xing:before {
  content: "\f168";
}
.fa-xing-square:before {
  content: "\f169";
}
.fa-youtube-play:before {
  content: "\f16a";
}
.fa-dropbox:before {
  content: "\f16b";
}
.fa-stack-overflow:before {
  content: "\f16c";
}
.fa-instagram:before {
  content: "\f16d";
}
.fa-flickr:before {
  content: "\f16e";
}
.fa-adn:before {
  content: "\f170";
}
.fa-bitbucket:before {
  content: "\f171";
}
.fa-bitbucket-square:before {
  content: "\f172";
}
.fa-tumblr:before {
  content: "\f173";
}
.fa-tumblr-square:before {
  content: "\f174";
}
.fa-long-arrow-down:before {
  content: "\f175";
}
.fa-long-arrow-up:before {
  content: "\f176";
}
.fa-long-arrow-left:before {
  content: "\f177";
}
.fa-long-arrow-right:before {
  content: "\f178";
}
.fa-apple:before {
  content: "\f179";
}
.fa-windows:before {
  content: "\f17a";
}
.fa-android:before {
  content: "\f17b";
}
.fa-linux:before {
  content: "\f17c";
}
.fa-dribbble:before {
  content: "\f17d";
}
.fa-skype:before {
  content: "\f17e";
}
.fa-foursquare:before {
  content: "\f180";
}
.fa-trello:before {
  content: "\f181";
}
.fa-female:before {
  content: "\f182";
}
.fa-male:before {
  content: "\f183";
}
.fa-gittip:before,
.fa-gratipay:before {
  content: "\f184";
}
.fa-sun-o:before {
  content: "\f185";
}
.fa-moon-o:before {
  content: "\f186";
}
.fa-archive:before {
  content: "\f187";
}
.fa-bug:before {
  content: "\f188";
}
.fa-vk:before {
  content: "\f189";
}
.fa-weibo:before {
  content: "\f18a";
}
.fa-renren:before {
  content: "\f18b";
}
.fa-pagelines:before {
  content: "\f18c";
}
.fa-stack-exchange:before {
  content: "\f18d";
}
.fa-arrow-circle-o-right:before {
  content: "\f18e";
}
.fa-arrow-circle-o-left:before {
  content: "\f190";
}
.fa-toggle-left:before,
.fa-caret-square-o-left:before {
  content: "\f191";
}
.fa-dot-circle-o:before {
  content: "\f192";
}
.fa-wheelchair:before {
  content: "\f193";
}
.fa-vimeo-square:before {
  content: "\f194";
}
.fa-turkish-lira:before,
.fa-try:before {
  content: "\f195";
}
.fa-plus-square-o:before {
  content: "\f196";
}
.fa-space-shuttle:before {
  content: "\f197";
}
.fa-slack:before {
  content: "\f198";
}
.fa-envelope-square:before {
  content: "\f199";
}
.fa-wordpress:before {
  content: "\f19a";
}
.fa-openid:before {
  content: "\f19b";
}
.fa-institution:before,
.fa-bank:before,
.fa-university:before {
  content: "\f19c";
}
.fa-mortar-board:before,
.fa-graduation-cap:before {
  content: "\f19d";
}
.fa-yahoo:before {
  content: "\f19e";
}
.fa-google:before {
  content: "\f1a0";
}
.fa-reddit:before {
  content: "\f1a1";
}
.fa-reddit-square:before {
  content: "\f1a2";
}
.fa-stumbleupon-circle:before {
  content: "\f1a3";
}
.fa-stumbleupon:before {
  content: "\f1a4";
}
.fa-delicious:before {
  content: "\f1a5";
}
.fa-digg:before {
  content: "\f1a6";
}
.fa-pied-piper-pp:before {
  content: "\f1a7";
}
.fa-pied-piper-alt:before {
  content: "\f1a8";
}
.fa-drupal:before {
  content: "\f1a9";
}
.fa-joomla:before {
  content: "\f1aa";
}
.fa-language:before {
  content: "\f1ab";
}
.fa-fax:before {
  content: "\f1ac";
}
.fa-building:before {
  content: "\f1ad";
}
.fa-child:before {
  content: "\f1ae";
}
.fa-paw:before {
  content: "\f1b0";
}
.fa-spoon:before {
  content: "\f1b1";
}
.fa-cube:before {
  content: "\f1b2";
}
.fa-cubes:before {
  content: "\f1b3";
}
.fa-behance:before {
  content: "\f1b4";
}
.fa-behance-square:before {
  content: "\f1b5";
}
.fa-steam:before {
  content: "\f1b6";
}
.fa-steam-square:before {
  content: "\f1b7";
}
.fa-recycle:before {
  content: "\f1b8";
}
.fa-automobile:before,
.fa-car:before {
  content: "\f1b9";
}
.fa-cab:before,
.fa-taxi:before {
  content: "\f1ba";
}
.fa-tree:before {
  content: "\f1bb";
}
.fa-spotify:before {
  content: "\f1bc";
}
.fa-deviantart:before {
  content: "\f1bd";
}
.fa-soundcloud:before {
  content: "\f1be";
}
.fa-database:before {
  content: "\f1c0";
}
.fa-file-pdf-o:before {
  content: "\f1c1";
}
.fa-file-word-o:before {
  content: "\f1c2";
}
.fa-file-excel-o:before {
  content: "\f1c3";
}
.fa-file-powerpoint-o:before {
  content: "\f1c4";
}
.fa-file-photo-o:before,
.fa-file-picture-o:before,
.fa-file-image-o:before {
  content: "\f1c5";
}
.fa-file-zip-o:before,
.fa-file-archive-o:before {
  content: "\f1c6";
}
.fa-file-sound-o:before,
.fa-file-audio-o:before {
  content: "\f1c7";
}
.fa-file-movie-o:before,
.fa-file-video-o:before {
  content: "\f1c8";
}
.fa-file-code-o:before {
  content: "\f1c9";
}
.fa-vine:before {
  content: "\f1ca";
}
.fa-codepen:before {
  content: "\f1cb";
}
.fa-jsfiddle:before {
  content: "\f1cc";
}
.fa-life-bouy:before,
.fa-life-buoy:before,
.fa-life-saver:before,
.fa-support:before,
.fa-life-ring:before {
  content: "\f1cd";
}
.fa-circle-o-notch:before {
  content: "\f1ce";
}
.fa-ra:before,
.fa-resistance:before,
.fa-rebel:before {
  content: "\f1d0";
}
.fa-ge:before,
.fa-empire:before {
  content: "\f1d1";
}
.fa-git-square:before {
  content: "\f1d2";
}
.fa-git:before {
  content: "\f1d3";
}
.fa-y-combinator-square:before,
.fa-yc-square:before,
.fa-hacker-news:before {
  content: "\f1d4";
}
.fa-tencent-weibo:before {
  content: "\f1d5";
}
.fa-qq:before {
  content: "\f1d6";
}
.fa-wechat:before,
.fa-weixin:before {
  content: "\f1d7";
}
.fa-send:before,
.fa-paper-plane:before {
  content: "\f1d8";
}
.fa-send-o:before,
.fa-paper-plane-o:before {
  content: "\f1d9";
}
.fa-history:before {
  content: "\f1da";
}
.fa-circle-thin:before {
  content: "\f1db";
}
.fa-header:before {
  content: "\f1dc";
}
.fa-paragraph:before {
  content: "\f1dd";
}
.fa-sliders:before {
  content: "\f1de";
}
.fa-share-alt:before {
  content: "\f1e0";
}
.fa-share-alt-square:before {
  content: "\f1e1";
}
.fa-bomb:before {
  content: "\f1e2";
}
.fa-soccer-ball-o:before,
.fa-futbol-o:before {
  content: "\f1e3";
}
.fa-tty:before {
  content: "\f1e4";
}
.fa-binoculars:before {
  content: "\f1e5";
}
.fa-plug:before {
  content: "\f1e6";
}
.fa-slideshare:before {
  content: "\f1e7";
}
.fa-twitch:before {
  content: "\f1e8";
}
.fa-yelp:before {
  content: "\f1e9";
}
.fa-newspaper-o:before {
  content: "\f1ea";
}
.fa-wifi:before {
  content: "\f1eb";
}
.fa-calculator:before {
  content: "\f1ec";
}
.fa-paypal:before {
  content: "\f1ed";
}
.fa-google-wallet:before {
  content: "\f1ee";
}
.fa-cc-visa:before {
  content: "\f1f0";
}
.fa-cc-mastercard:before {
  content: "\f1f1";
}
.fa-cc-discover:before {
  content: "\f1f2";
}
.fa-cc-amex:before {
  content: "\f1f3";
}
.fa-cc-paypal:before {
  content: "\f1f4";
}
.fa-cc-stripe:before {
  content: "\f1f5";
}
.fa-bell-slash:before {
  content: "\f1f6";
}
.fa-bell-slash-o:before {
  content: "\f1f7";
}
.fa-trash:before {
  content: "\f1f8";
}
.fa-copyright:before {
  content: "\f1f9";
}
.fa-at:before {
  content: "\f1fa";
}
.fa-eyedropper:before {
  content: "\f1fb";
}
.fa-paint-brush:before {
  content: "\f1fc";
}
.fa-birthday-cake:before {
  content: "\f1fd";
}
.fa-area-chart:before {
  content: "\f1fe";
}
.fa-pie-chart:before {
  content: "\f200";
}
.fa-line-chart:before {
  content: "\f201";
}
.fa-lastfm:before {
  content: "\f202";
}
.fa-lastfm-square:before {
  content: "\f203";
}
.fa-toggle-off:before {
  content: "\f204";
}
.fa-toggle-on:before {
  content: "\f205";
}
.fa-bicycle:before {
  content: "\f206";
}
.fa-bus:before {
  content: "\f207";
}
.fa-ioxhost:before {
  content: "\f208";
}
.fa-angellist:before {
  content: "\f209";
}
.fa-cc:before {
  content: "\f20a";
}
.fa-shekel:before,
.fa-sheqel:before,
.fa-ils:before {
  content: "\f20b";
}
.fa-meanpath:before {
  content: "\f20c";
}
.fa-buysellads:before {
  content: "\f20d";
}
.fa-connectdevelop:before {
  content: "\f20e";
}
.fa-dashcube:before {
  content: "\f210";
}
.fa-forumbee:before {
  content: "\f211";
}
.fa-leanpub:before {
  content: "\f212";
}
.fa-sellsy:before {
  content: "\f213";
}
.fa-shirtsinbulk:before {
  content: "\f214";
}
.fa-simplybuilt:before {
  content: "\f215";
}
.fa-skyatlas:before {
  content: "\f216";
}
.fa-cart-plus:before {
  content: "\f217";
}
.fa-cart-arrow-down:before {
  content: "\f218";
}
.fa-diamond:before {
  content: "\f219";
}
.fa-ship:before {
  content: "\f21a";
}
.fa-user-secret:before {
  content: "\f21b";
}
.fa-motorcycle:before {
  content: "\f21c";
}
.fa-street-view:before {
  content: "\f21d";
}
.fa-heartbeat:before {
  content: "\f21e";
}
.fa-venus:before {
  content: "\f221";
}
.fa-mars:before {
  content: "\f222";
}
.fa-mercury:before {
  content: "\f223";
}
.fa-intersex:before,
.fa-transgender:before {
  content: "\f224";
}
.fa-transgender-alt:before {
  content: "\f225";
}
.fa-venus-double:before {
  content: "\f226";
}
.fa-mars-double:before {
  content: "\f227";
}
.fa-venus-mars:before {
  content: "\f228";
}
.fa-mars-stroke:before {
  content: "\f229";
}
.fa-mars-stroke-v:before {
  content: "\f22a";
}
.fa-mars-stroke-h:before {
  content: "\f22b";
}
.fa-neuter:before {
  content: "\f22c";
}
.fa-genderless:before {
  content: "\f22d";
}
.fa-facebook-official:before {
  content: "\f230";
}
.fa-pinterest-p:before {
  content: "\f231";
}
.fa-whatsapp:before {
  content: "\f232";
}
.fa-server:before {
  content: "\f233";
}
.fa-user-plus:before {
  content: "\f234";
}
.fa-user-times:before {
  content: "\f235";
}
.fa-hotel:before,
.fa-bed:before {
  content: "\f236";
}
.fa-viacoin:before {
  content: "\f237";
}
.fa-train:before {
  content: "\f238";
}
.fa-subway:before {
  content: "\f239";
}
.fa-medium:before {
  content: "\f23a";
}
.fa-yc:before,
.fa-y-combinator:before {
  content: "\f23b";
}
.fa-optin-monster:before {
  content: "\f23c";
}
.fa-opencart:before {
  content: "\f23d";
}
.fa-expeditedssl:before {
  content: "\f23e";
}
.fa-battery-4:before,
.fa-battery:before,
.fa-battery-full:before {
  content: "\f240";
}
.fa-battery-3:before,
.fa-battery-three-quarters:before {
  content: "\f241";
}
.fa-battery-2:before,
.fa-battery-half:before {
  content: "\f242";
}
.fa-battery-1:before,
.fa-battery-quarter:before {
  content: "\f243";
}
.fa-battery-0:before,
.fa-battery-empty:before {
  content: "\f244";
}
.fa-mouse-pointer:before {
  content: "\f245";
}
.fa-i-cursor:before {
  content: "\f246";
}
.fa-object-group:before {
  content: "\f247";
}
.fa-object-ungroup:before {
  content: "\f248";
}
.fa-sticky-note:before {
  content: "\f249";
}
.fa-sticky-note-o:before {
  content: "\f24a";
}
.fa-cc-jcb:before {
  content: "\f24b";
}
.fa-cc-diners-club:before {
  content: "\f24c";
}
.fa-clone:before {
  content: "\f24d";
}
.fa-balance-scale:before {
  content: "\f24e";
}
.fa-hourglass-o:before {
  content: "\f250";
}
.fa-hourglass-1:before,
.fa-hourglass-start:before {
  content: "\f251";
}
.fa-hourglass-2:before,
.fa-hourglass-half:before {
  content: "\f252";
}
.fa-hourglass-3:before,
.fa-hourglass-end:before {
  content: "\f253";
}
.fa-hourglass:before {
  content: "\f254";
}
.fa-hand-grab-o:before,
.fa-hand-rock-o:before {
  content: "\f255";
}
.fa-hand-stop-o:before,
.fa-hand-paper-o:before {
  content: "\f256";
}
.fa-hand-scissors-o:before {
  content: "\f257";
}
.fa-hand-lizard-o:before {
  content: "\f258";
}
.fa-hand-spock-o:before {
  content: "\f259";
}
.fa-hand-pointer-o:before {
  content: "\f25a";
}
.fa-hand-peace-o:before {
  content: "\f25b";
}
.fa-trademark:before {
  content: "\f25c";
}
.fa-registered:before {
  content: "\f25d";
}
.fa-creative-commons:before {
  content: "\f25e";
}
.fa-gg:before {
  content: "\f260";
}
.fa-gg-circle:before {
  content: "\f261";
}
.fa-tripadvisor:before {
  content: "\f262";
}
.fa-odnoklassniki:before {
  content: "\f263";
}
.fa-odnoklassniki-square:before {
  content: "\f264";
}
.fa-get-pocket:before {
  content: "\f265";
}
.fa-wikipedia-w:before {
  content: "\f266";
}
.fa-safari:before {
  content: "\f267";
}
.fa-chrome:before {
  content: "\f268";
}
.fa-firefox:before {
  content: "\f269";
}
.fa-opera:before {
  content: "\f26a";
}
.fa-internet-explorer:before {
  content: "\f26b";
}
.fa-tv:before,
.fa-television:before {
  content: "\f26c";
}
.fa-contao:before {
  content: "\f26d";
}
.fa-500px:before {
  content: "\f26e";
}
.fa-amazon:before {
  content: "\f270";
}
.fa-calendar-plus-o:before {
  content: "\f271";
}
.fa-calendar-minus-o:before {
  content: "\f272";
}
.fa-calendar-times-o:before {
  content: "\f273";
}
.fa-calendar-check-o:before {
  content: "\f274";
}
.fa-industry:before {
  content: "\f275";
}
.fa-map-pin:before {
  content: "\f276";
}
.fa-map-signs:before {
  content: "\f277";
}
.fa-map-o:before {
  content: "\f278";
}
.fa-map:before {
  content: "\f279";
}
.fa-commenting:before {
  content: "\f27a";
}
.fa-commenting-o:before {
  content: "\f27b";
}
.fa-houzz:before {
  content: "\f27c";
}
.fa-vimeo:before {
  content: "\f27d";
}
.fa-black-tie:before {
  content: "\f27e";
}
.fa-fonticons:before {
  content: "\f280";
}
.fa-reddit-alien:before {
  content: "\f281";
}
.fa-edge:before {
  content: "\f282";
}
.fa-credit-card-alt:before {
  content: "\f283";
}
.fa-codiepie:before {
  content: "\f284";
}
.fa-modx:before {
  content: "\f285";
}
.fa-fort-awesome:before {
  content: "\f286";
}
.fa-usb:before {
  content: "\f287";
}
.fa-product-hunt:before {
  content: "\f288";
}
.fa-mixcloud:before {
  content: "\f289";
}
.fa-scribd:before {
  content: "\f28a";
}
.fa-pause-circle:before {
  content: "\f28b";
}
.fa-pause-circle-o:before {
  content: "\f28c";
}
.fa-stop-circle:before {
  content: "\f28d";
}
.fa-stop-circle-o:before {
  content: "\f28e";
}
.fa-shopping-bag:before {
  content: "\f290";
}
.fa-shopping-basket:before {
  content: "\f291";
}
.fa-hashtag:before {
  content: "\f292";
}
.fa-bluetooth:before {
  content: "\f293";
}
.fa-bluetooth-b:before {
  content: "\f294";
}
.fa-percent:before {
  content: "\f295";
}
.fa-gitlab:before {
  content: "\f296";
}
.fa-wpbeginner:before {
  content: "\f297";
}
.fa-wpforms:before {
  content: "\f298";
}
.fa-envira:before {
  content: "\f299";
}
.fa-universal-access:before {
  content: "\f29a";
}
.fa-wheelchair-alt:before {
  content: "\f29b";
}
.fa-question-circle-o:before {
  content: "\f29c";
}
.fa-blind:before {
  content: "\f29d";
}
.fa-audio-description:before {
  content: "\f29e";
}
.fa-volume-control-phone:before {
  content: "\f2a0";
}
.fa-braille:before {
  content: "\f2a1";
}
.fa-assistive-listening-systems:before {
  content: "\f2a2";
}
.fa-asl-interpreting:before,
.fa-american-sign-language-interpreting:before {
  content: "\f2a3";
}
.fa-deafness:before,
.fa-hard-of-hearing:before,
.fa-deaf:before {
  content: "\f2a4";
}
.fa-glide:before {
  content: "\f2a5";
}
.fa-glide-g:before {
  content: "\f2a6";
}
.fa-signing:before,
.fa-sign-language:before {
  content: "\f2a7";
}
.fa-low-vision:before {
  content: "\f2a8";
}
.fa-viadeo:before {
  content: "\f2a9";
}
.fa-viadeo-square:before {
  content: "\f2aa";
}
.fa-snapchat:before {
  content: "\f2ab";
}
.fa-snapchat-ghost:before {
  content: "\f2ac";
}
.fa-snapchat-square:before {
  content: "\f2ad";
}
.fa-pied-piper:before {
  content: "\f2ae";
}
.fa-first-order:before {
  content: "\f2b0";
}
.fa-yoast:before {
  content: "\f2b1";
}
.fa-themeisle:before {
  content: "\f2b2";
}
.fa-google-plus-circle:before,
.fa-google-plus-official:before {
  content: "\f2b3";
}
.fa-fa:before,
.fa-font-awesome:before {
  content: "\f2b4";
}
.fa-handshake-o:before {
  content: "\f2b5";
}
.fa-envelope-open:before {
  content: "\f2b6";
}
.fa-envelope-open-o:before {
  content: "\f2b7";
}
.fa-linode:before {
  content: "\f2b8";
}
.fa-address-book:before {
  content: "\f2b9";
}
.fa-address-book-o:before {
  content: "\f2ba";
}
.fa-vcard:before,
.fa-address-card:before {
  content: "\f2bb";
}
.fa-vcard-o:before,
.fa-address-card-o:before {
  content: "\f2bc";
}
.fa-user-circle:before {
  content: "\f2bd";
}
.fa-user-circle-o:before {
  content: "\f2be";
}
.fa-user-o:before {
  content: "\f2c0";
}
.fa-id-badge:before {
  content: "\f2c1";
}
.fa-drivers-license:before,
.fa-id-card:before {
  content: "\f2c2";
}
.fa-drivers-license-o:before,
.fa-id-card-o:before {
  content: "\f2c3";
}
.fa-quora:before {
  content: "\f2c4";
}
.fa-free-code-camp:before {
  content: "\f2c5";
}
.fa-telegram:before {
  content: "\f2c6";
}
.fa-thermometer-4:before,
.fa-thermometer:before,
.fa-thermometer-full:before {
  content: "\f2c7";
}
.fa-thermometer-3:before,
.fa-thermometer-three-quarters:before {
  content: "\f2c8";
}
.fa-thermometer-2:before,
.fa-thermometer-half:before {
  content: "\f2c9";
}
.fa-thermometer-1:before,
.fa-thermometer-quarter:before {
  content: "\f2ca";
}
.fa-thermometer-0:before,
.fa-thermometer-empty:before {
  content: "\f2cb";
}
.fa-shower:before {
  content: "\f2cc";
}
.fa-bathtub:before,
.fa-s15:before,
.fa-bath:before {
  content: "\f2cd";
}
.fa-podcast:before {
  content: "\f2ce";
}
.fa-window-maximize:before {
  content: "\f2d0";
}
.fa-window-minimize:before {
  content: "\f2d1";
}
.fa-window-restore:before {
  content: "\f2d2";
}
.fa-times-rectangle:before,
.fa-window-close:before {
  content: "\f2d3";
}
.fa-times-rectangle-o:before,
.fa-window-close-o:before {
  content: "\f2d4";
}
.fa-bandcamp:before {
  content: "\f2d5";
}
.fa-grav:before {
  content: "\f2d6";
}
.fa-etsy:before {
  content: "\f2d7";
}
.fa-imdb:before {
  content: "\f2d8";
}
.fa-ravelry:before {
  content: "\f2d9";
}
.fa-eercast:before {
  content: "\f2da";
}
.fa-microchip:before {
  content: "\f2db";
}
.fa-snowflake-o:before {
  content: "\f2dc";
}
.fa-superpowers:before {
  content: "\f2dd";
}
.fa-wpexplorer:before {
  content: "\f2de";
}
.fa-meetup:before {
  content: "\f2e0";
}
.sr-only {
  position: absolute;
  width: 1px;
  height: 1px;
  padding: 0;
  margin: -1px;
  overflow: hidden;
  clip: rect(0, 0, 0, 0);
  border: 0;
}
.sr-only-focusable:active,
.sr-only-focusable:focus {
  position: static;
  width: auto;
  height: auto;
  margin: 0;
  overflow: visible;
  clip: auto;
}
.sr-only-focusable:active,
.sr-only-focusable:focus {
  position: static;
  width: auto;
  height: auto;
  margin: 0;
  overflow: visible;
  clip: auto;
}
/*!
*
* IPython base
*
*/
.modal.fade .modal-dialog {
  -webkit-transform: translate(0, 0);
  -ms-transform: translate(0, 0);
  -o-transform: translate(0, 0);
  transform: translate(0, 0);
}
code {
  color: #000;
}
pre {
  font-size: inherit;
  line-height: inherit;
}
label {
  font-weight: normal;
}
/* Make the page background atleast 100% the height of the view port */
/* Make the page itself atleast 70% the height of the view port */
.border-box-sizing {
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
}
.corner-all {
  border-radius: 2px;
}
.no-padding {
  padding: 0px;
}
/* Flexible box model classes */
/* Taken from Alex Russell http://infrequently.org/2009/08/css-3-progress/ */
/* This file is a compatability layer.  It allows the usage of flexible box 
model layouts accross multiple browsers, including older browsers.  The newest,
universal implementation of the flexible box model is used when available (see
`Modern browsers` comments below).  Browsers that are known to implement this 
new spec completely include:

    Firefox 28.0+
    Chrome 29.0+
    Internet Explorer 11+ 
    Opera 17.0+

Browsers not listed, including Safari, are supported via the styling under the
`Old browsers` comments below.
*/
.hbox {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
}
.hbox > * {
  /* Old browsers */
  -webkit-box-flex: 0;
  -moz-box-flex: 0;
  box-flex: 0;
  /* Modern browsers */
  flex: none;
}
.vbox {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
}
.vbox > * {
  /* Old browsers */
  -webkit-box-flex: 0;
  -moz-box-flex: 0;
  box-flex: 0;
  /* Modern browsers */
  flex: none;
}
.hbox.reverse,
.vbox.reverse,
.reverse {
  /* Old browsers */
  -webkit-box-direction: reverse;
  -moz-box-direction: reverse;
  box-direction: reverse;
  /* Modern browsers */
  flex-direction: row-reverse;
}
.hbox.box-flex0,
.vbox.box-flex0,
.box-flex0 {
  /* Old browsers */
  -webkit-box-flex: 0;
  -moz-box-flex: 0;
  box-flex: 0;
  /* Modern browsers */
  flex: none;
  width: auto;
}
.hbox.box-flex1,
.vbox.box-flex1,
.box-flex1 {
  /* Old browsers */
  -webkit-box-flex: 1;
  -moz-box-flex: 1;
  box-flex: 1;
  /* Modern browsers */
  flex: 1;
}
.hbox.box-flex,
.vbox.box-flex,
.box-flex {
  /* Old browsers */
  /* Old browsers */
  -webkit-box-flex: 1;
  -moz-box-flex: 1;
  box-flex: 1;
  /* Modern browsers */
  flex: 1;
}
.hbox.box-flex2,
.vbox.box-flex2,
.box-flex2 {
  /* Old browsers */
  -webkit-box-flex: 2;
  -moz-box-flex: 2;
  box-flex: 2;
  /* Modern browsers */
  flex: 2;
}
.box-group1 {
  /*  Deprecated */
  -webkit-box-flex-group: 1;
  -moz-box-flex-group: 1;
  box-flex-group: 1;
}
.box-group2 {
  /* Deprecated */
  -webkit-box-flex-group: 2;
  -moz-box-flex-group: 2;
  box-flex-group: 2;
}
.hbox.start,
.vbox.start,
.start {
  /* Old browsers */
  -webkit-box-pack: start;
  -moz-box-pack: start;
  box-pack: start;
  /* Modern browsers */
  justify-content: flex-start;
}
.hbox.end,
.vbox.end,
.end {
  /* Old browsers */
  -webkit-box-pack: end;
  -moz-box-pack: end;
  box-pack: end;
  /* Modern browsers */
  justify-content: flex-end;
}
.hbox.center,
.vbox.center,
.center {
  /* Old browsers */
  -webkit-box-pack: center;
  -moz-box-pack: center;
  box-pack: center;
  /* Modern browsers */
  justify-content: center;
}
.hbox.baseline,
.vbox.baseline,
.baseline {
  /* Old browsers */
  -webkit-box-pack: baseline;
  -moz-box-pack: baseline;
  box-pack: baseline;
  /* Modern browsers */
  justify-content: baseline;
}
.hbox.stretch,
.vbox.stretch,
.stretch {
  /* Old browsers */
  -webkit-box-pack: stretch;
  -moz-box-pack: stretch;
  box-pack: stretch;
  /* Modern browsers */
  justify-content: stretch;
}
.hbox.align-start,
.vbox.align-start,
.align-start {
  /* Old browsers */
  -webkit-box-align: start;
  -moz-box-align: start;
  box-align: start;
  /* Modern browsers */
  align-items: flex-start;
}
.hbox.align-end,
.vbox.align-end,
.align-end {
  /* Old browsers */
  -webkit-box-align: end;
  -moz-box-align: end;
  box-align: end;
  /* Modern browsers */
  align-items: flex-end;
}
.hbox.align-center,
.vbox.align-center,
.align-center {
  /* Old browsers */
  -webkit-box-align: center;
  -moz-box-align: center;
  box-align: center;
  /* Modern browsers */
  align-items: center;
}
.hbox.align-baseline,
.vbox.align-baseline,
.align-baseline {
  /* Old browsers */
  -webkit-box-align: baseline;
  -moz-box-align: baseline;
  box-align: baseline;
  /* Modern browsers */
  align-items: baseline;
}
.hbox.align-stretch,
.vbox.align-stretch,
.align-stretch {
  /* Old browsers */
  -webkit-box-align: stretch;
  -moz-box-align: stretch;
  box-align: stretch;
  /* Modern browsers */
  align-items: stretch;
}
div.error {
  margin: 2em;
  text-align: center;
}
div.error > h1 {
  font-size: 500%;
  line-height: normal;
}
div.error > p {
  font-size: 200%;
  line-height: normal;
}
div.traceback-wrapper {
  text-align: left;
  max-width: 800px;
  margin: auto;
}
div.traceback-wrapper pre.traceback {
  max-height: 600px;
  overflow: auto;
}
/**
 * Primary styles
 *
 * Author: Jupyter Development Team
 */
body {
  background-color: #fff;
  /* This makes sure that the body covers the entire window and needs to
       be in a different element than the display: box in wrapper below */
  position: absolute;
  left: 0px;
  right: 0px;
  top: 0px;
  bottom: 0px;
  overflow: visible;
}
body > #header {
  /* Initially hidden to prevent FLOUC */
  display: none;
  background-color: #fff;
  /* Display over codemirror */
  position: relative;
  z-index: 100;
}
body > #header #header-container {
  display: flex;
  flex-direction: row;
  justify-content: space-between;
  padding: 5px;
  padding-bottom: 5px;
  padding-top: 5px;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
}
body > #header .header-bar {
  width: 100%;
  height: 1px;
  background: #e7e7e7;
  margin-bottom: -1px;
}
@media print {
  body > #header {
    display: none !important;
  }
}
#header-spacer {
  width: 100%;
  visibility: hidden;
}
@media print {
  #header-spacer {
    display: none;
  }
}
#ipython_notebook {
  padding-left: 0px;
  padding-top: 1px;
  padding-bottom: 1px;
}
[dir="rtl"] #ipython_notebook {
  margin-right: 10px;
  margin-left: 0;
}
[dir="rtl"] #ipython_notebook.pull-left {
  float: right !important;
  float: right;
}
.flex-spacer {
  flex: 1;
}
#noscript {
  width: auto;
  padding-top: 16px;
  padding-bottom: 16px;
  text-align: center;
  font-size: 22px;
  color: red;
  font-weight: bold;
}
#ipython_notebook img {
  height: 28px;
}
#site {
  width: 100%;
  display: none;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  overflow: auto;
}
@media print {
  #site {
    height: auto !important;
  }
}
/* Smaller buttons */
.ui-button .ui-button-text {
  padding: 0.2em 0.8em;
  font-size: 77%;
}
input.ui-button {
  padding: 0.3em 0.9em;
}
span#kernel_logo_widget {
  margin: 0 10px;
}
span#login_widget {
  float: right;
}
[dir="rtl"] span#login_widget {
  float: left;
}
span#login_widget > .button,
#logout {
  color: #333;
  background-color: #fff;
  border-color: #ccc;
}
span#login_widget > .button:focus,
#logout:focus,
span#login_widget > .button.focus,
#logout.focus {
  color: #333;
  background-color: #e6e6e6;
  border-color: #8c8c8c;
}
span#login_widget > .button:hover,
#logout:hover {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
span#login_widget > .button:active,
#logout:active,
span#login_widget > .button.active,
#logout.active,
.open > .dropdown-togglespan#login_widget > .button,
.open > .dropdown-toggle#logout {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
span#login_widget > .button:active:hover,
#logout:active:hover,
span#login_widget > .button.active:hover,
#logout.active:hover,
.open > .dropdown-togglespan#login_widget > .button:hover,
.open > .dropdown-toggle#logout:hover,
span#login_widget > .button:active:focus,
#logout:active:focus,
span#login_widget > .button.active:focus,
#logout.active:focus,
.open > .dropdown-togglespan#login_widget > .button:focus,
.open > .dropdown-toggle#logout:focus,
span#login_widget > .button:active.focus,
#logout:active.focus,
span#login_widget > .button.active.focus,
#logout.active.focus,
.open > .dropdown-togglespan#login_widget > .button.focus,
.open > .dropdown-toggle#logout.focus {
  color: #333;
  background-color: #d4d4d4;
  border-color: #8c8c8c;
}
span#login_widget > .button:active,
#logout:active,
span#login_widget > .button.active,
#logout.active,
.open > .dropdown-togglespan#login_widget > .button,
.open > .dropdown-toggle#logout {
  background-image: none;
}
span#login_widget > .button.disabled:hover,
#logout.disabled:hover,
span#login_widget > .button[disabled]:hover,
#logout[disabled]:hover,
fieldset[disabled] span#login_widget > .button:hover,
fieldset[disabled] #logout:hover,
span#login_widget > .button.disabled:focus,
#logout.disabled:focus,
span#login_widget > .button[disabled]:focus,
#logout[disabled]:focus,
fieldset[disabled] span#login_widget > .button:focus,
fieldset[disabled] #logout:focus,
span#login_widget > .button.disabled.focus,
#logout.disabled.focus,
span#login_widget > .button[disabled].focus,
#logout[disabled].focus,
fieldset[disabled] span#login_widget > .button.focus,
fieldset[disabled] #logout.focus {
  background-color: #fff;
  border-color: #ccc;
}
span#login_widget > .button .badge,
#logout .badge {
  color: #fff;
  background-color: #333;
}
.nav-header {
  text-transform: none;
}
#header > span {
  margin-top: 10px;
}
.modal_stretch .modal-dialog {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
  min-height: 80vh;
}
.modal_stretch .modal-dialog .modal-body {
  max-height: calc(100vh - 200px);
  overflow: auto;
  flex: 1;
}
.modal-header {
  cursor: move;
}
@media (min-width: 768px) {
  .modal .modal-dialog {
    width: 700px;
  }
}
@media (min-width: 768px) {
  select.form-control {
    margin-left: 12px;
    margin-right: 12px;
  }
}
/*!
*
* IPython auth
*
*/
.center-nav {
  display: inline-block;
  margin-bottom: -4px;
}
[dir="rtl"] .center-nav form.pull-left {
  float: right !important;
  float: right;
}
[dir="rtl"] .center-nav .navbar-text {
  float: right;
}
[dir="rtl"] .navbar-inner {
  text-align: right;
}
[dir="rtl"] div.text-left {
  text-align: right;
}
/*!
*
* IPython tree view
*
*/
/* We need an invisible input field on top of the sentense*/
/* "Drag file onto the list ..." */
.alternate_upload {
  background-color: none;
  display: inline;
}
.alternate_upload.form {
  padding: 0;
  margin: 0;
}
.alternate_upload input.fileinput {
  position: absolute;
  display: block;
  width: 100%;
  height: 100%;
  overflow: hidden;
  cursor: pointer;
  opacity: 0;
  z-index: 2;
}
.alternate_upload .btn-xs > input.fileinput {
  margin: -1px -5px;
}
.alternate_upload .btn-upload {
  position: relative;
  height: 22px;
}
::-webkit-file-upload-button {
  cursor: pointer;
}
/**
 * Primary styles
 *
 * Author: Jupyter Development Team
 */
ul#tabs {
  margin-bottom: 4px;
}
ul#tabs a {
  padding-top: 6px;
  padding-bottom: 4px;
}
[dir="rtl"] ul#tabs.nav-tabs > li {
  float: right;
}
[dir="rtl"] ul#tabs.nav.nav-tabs {
  padding-right: 0;
}
ul.breadcrumb a:focus,
ul.breadcrumb a:hover {
  text-decoration: none;
}
ul.breadcrumb i.icon-home {
  font-size: 16px;
  margin-right: 4px;
}
ul.breadcrumb span {
  color: #5e5e5e;
}
.list_toolbar {
  padding: 4px 0 4px 0;
  vertical-align: middle;
}
.list_toolbar .tree-buttons {
  padding-top: 1px;
}
[dir="rtl"] .list_toolbar .tree-buttons .pull-right {
  float: left !important;
  float: left;
}
[dir="rtl"] .list_toolbar .col-sm-4,
[dir="rtl"] .list_toolbar .col-sm-8 {
  float: right;
}
.dynamic-buttons {
  padding-top: 3px;
  display: inline-block;
}
.list_toolbar [class*="span"] {
  min-height: 24px;
}
.list_header {
  font-weight: bold;
  background-color: #EEE;
}
.list_placeholder {
  font-weight: bold;
  padding-top: 4px;
  padding-bottom: 4px;
  padding-left: 7px;
  padding-right: 7px;
}
.list_container {
  margin-top: 4px;
  margin-bottom: 20px;
  border: 1px solid #ddd;
  border-radius: 2px;
}
.list_container > div {
  border-bottom: 1px solid #ddd;
}
.list_container > div:hover .list-item {
  background-color: red;
}
.list_container > div:last-child {
  border: none;
}
.list_item:hover .list_item {
  background-color: #ddd;
}
.list_item a {
  text-decoration: none;
}
.list_item:hover {
  background-color: #fafafa;
}
.list_header > div,
.list_item > div {
  padding-top: 4px;
  padding-bottom: 4px;
  padding-left: 7px;
  padding-right: 7px;
  line-height: 22px;
}
.list_header > div input,
.list_item > div input {
  margin-right: 7px;
  margin-left: 14px;
  vertical-align: text-bottom;
  line-height: 22px;
  position: relative;
  top: -1px;
}
.list_header > div .item_link,
.list_item > div .item_link {
  margin-left: -1px;
  vertical-align: baseline;
  line-height: 22px;
}
[dir="rtl"] .list_item > div input {
  margin-right: 0;
}
.new-file input[type=checkbox] {
  visibility: hidden;
}
.item_name {
  line-height: 22px;
  height: 24px;
}
.item_icon {
  font-size: 14px;
  color: #5e5e5e;
  margin-right: 7px;
  margin-left: 7px;
  line-height: 22px;
  vertical-align: baseline;
}
.item_modified {
  margin-right: 7px;
  margin-left: 7px;
}
[dir="rtl"] .item_modified.pull-right {
  float: left !important;
  float: left;
}
.item_buttons {
  line-height: 1em;
  margin-left: -5px;
}
.item_buttons .btn,
.item_buttons .btn-group,
.item_buttons .input-group {
  float: left;
}
.item_buttons > .btn,
.item_buttons > .btn-group,
.item_buttons > .input-group {
  margin-left: 5px;
}
.item_buttons .btn {
  min-width: 13ex;
}
.item_buttons .running-indicator {
  padding-top: 4px;
  color: #5cb85c;
}
.item_buttons .kernel-name {
  padding-top: 4px;
  color: #5bc0de;
  margin-right: 7px;
  float: left;
}
[dir="rtl"] .item_buttons.pull-right {
  float: left !important;
  float: left;
}
[dir="rtl"] .item_buttons .kernel-name {
  margin-left: 7px;
  float: right;
}
.toolbar_info {
  height: 24px;
  line-height: 24px;
}
.list_item input:not([type=checkbox]) {
  padding-top: 3px;
  padding-bottom: 3px;
  height: 22px;
  line-height: 14px;
  margin: 0px;
}
.highlight_text {
  color: blue;
}
#project_name {
  display: inline-block;
  padding-left: 7px;
  margin-left: -2px;
}
#project_name > .breadcrumb {
  padding: 0px;
  margin-bottom: 0px;
  background-color: transparent;
  font-weight: bold;
}
.sort_button {
  display: inline-block;
  padding-left: 7px;
}
[dir="rtl"] .sort_button.pull-right {
  float: left !important;
  float: left;
}
#tree-selector {
  padding-right: 0px;
}
#button-select-all {
  min-width: 50px;
}
[dir="rtl"] #button-select-all.btn {
  float: right ;
}
#select-all {
  margin-left: 7px;
  margin-right: 2px;
  margin-top: 2px;
  height: 16px;
}
[dir="rtl"] #select-all.pull-left {
  float: right !important;
  float: right;
}
.menu_icon {
  margin-right: 2px;
}
.tab-content .row {
  margin-left: 0px;
  margin-right: 0px;
}
.folder_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f114";
}
.folder_icon:before.fa-pull-left {
  margin-right: .3em;
}
.folder_icon:before.fa-pull-right {
  margin-left: .3em;
}
.folder_icon:before.pull-left {
  margin-right: .3em;
}
.folder_icon:before.pull-right {
  margin-left: .3em;
}
.notebook_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f02d";
  position: relative;
  top: -1px;
}
.notebook_icon:before.fa-pull-left {
  margin-right: .3em;
}
.notebook_icon:before.fa-pull-right {
  margin-left: .3em;
}
.notebook_icon:before.pull-left {
  margin-right: .3em;
}
.notebook_icon:before.pull-right {
  margin-left: .3em;
}
.running_notebook_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f02d";
  position: relative;
  top: -1px;
  color: #5cb85c;
}
.running_notebook_icon:before.fa-pull-left {
  margin-right: .3em;
}
.running_notebook_icon:before.fa-pull-right {
  margin-left: .3em;
}
.running_notebook_icon:before.pull-left {
  margin-right: .3em;
}
.running_notebook_icon:before.pull-right {
  margin-left: .3em;
}
.file_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f016";
  position: relative;
  top: -2px;
}
.file_icon:before.fa-pull-left {
  margin-right: .3em;
}
.file_icon:before.fa-pull-right {
  margin-left: .3em;
}
.file_icon:before.pull-left {
  margin-right: .3em;
}
.file_icon:before.pull-right {
  margin-left: .3em;
}
#notebook_toolbar .pull-right {
  padding-top: 0px;
  margin-right: -1px;
}
ul#new-menu {
  left: auto;
  right: 0;
}
#new-menu .dropdown-header {
  font-size: 10px;
  border-bottom: 1px solid #e5e5e5;
  padding: 0 0 3px;
  margin: -3px 20px 0;
}
.kernel-menu-icon {
  padding-right: 12px;
  width: 24px;
  content: "\f096";
}
.kernel-menu-icon:before {
  content: "\f096";
}
.kernel-menu-icon-current:before {
  content: "\f00c";
}
#tab_content {
  padding-top: 20px;
}
#running .panel-group .panel {
  margin-top: 3px;
  margin-bottom: 1em;
}
#running .panel-group .panel .panel-heading {
  background-color: #EEE;
  padding-top: 4px;
  padding-bottom: 4px;
  padding-left: 7px;
  padding-right: 7px;
  line-height: 22px;
}
#running .panel-group .panel .panel-heading a:focus,
#running .panel-group .panel .panel-heading a:hover {
  text-decoration: none;
}
#running .panel-group .panel .panel-body {
  padding: 0px;
}
#running .panel-group .panel .panel-body .list_container {
  margin-top: 0px;
  margin-bottom: 0px;
  border: 0px;
  border-radius: 0px;
}
#running .panel-group .panel .panel-body .list_container .list_item {
  border-bottom: 1px solid #ddd;
}
#running .panel-group .panel .panel-body .list_container .list_item:last-child {
  border-bottom: 0px;
}
.delete-button {
  display: none;
}
.duplicate-button {
  display: none;
}
.rename-button {
  display: none;
}
.move-button {
  display: none;
}
.download-button {
  display: none;
}
.shutdown-button {
  display: none;
}
.dynamic-instructions {
  display: inline-block;
  padding-top: 4px;
}
/*!
*
* IPython text editor webapp
*
*/
.selected-keymap i.fa {
  padding: 0px 5px;
}
.selected-keymap i.fa:before {
  content: "\f00c";
}
#mode-menu {
  overflow: auto;
  max-height: 20em;
}
.edit_app #header {
  -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
}
.edit_app #menubar .navbar {
  /* Use a negative 1 bottom margin, so the border overlaps the border of the
    header */
  margin-bottom: -1px;
}
.dirty-indicator {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  width: 20px;
}
.dirty-indicator.fa-pull-left {
  margin-right: .3em;
}
.dirty-indicator.fa-pull-right {
  margin-left: .3em;
}
.dirty-indicator.pull-left {
  margin-right: .3em;
}
.dirty-indicator.pull-right {
  margin-left: .3em;
}
.dirty-indicator-dirty {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  width: 20px;
}
.dirty-indicator-dirty.fa-pull-left {
  margin-right: .3em;
}
.dirty-indicator-dirty.fa-pull-right {
  margin-left: .3em;
}
.dirty-indicator-dirty.pull-left {
  margin-right: .3em;
}
.dirty-indicator-dirty.pull-right {
  margin-left: .3em;
}
.dirty-indicator-clean {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  width: 20px;
}
.dirty-indicator-clean.fa-pull-left {
  margin-right: .3em;
}
.dirty-indicator-clean.fa-pull-right {
  margin-left: .3em;
}
.dirty-indicator-clean.pull-left {
  margin-right: .3em;
}
.dirty-indicator-clean.pull-right {
  margin-left: .3em;
}
.dirty-indicator-clean:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f00c";
}
.dirty-indicator-clean:before.fa-pull-left {
  margin-right: .3em;
}
.dirty-indicator-clean:before.fa-pull-right {
  margin-left: .3em;
}
.dirty-indicator-clean:before.pull-left {
  margin-right: .3em;
}
.dirty-indicator-clean:before.pull-right {
  margin-left: .3em;
}
#filename {
  font-size: 16pt;
  display: table;
  padding: 0px 5px;
}
#current-mode {
  padding-left: 5px;
  padding-right: 5px;
}
#texteditor-backdrop {
  padding-top: 20px;
  padding-bottom: 20px;
}
@media not print {
  #texteditor-backdrop {
    background-color: #EEE;
  }
}
@media print {
  #texteditor-backdrop #texteditor-container .CodeMirror-gutter,
  #texteditor-backdrop #texteditor-container .CodeMirror-gutters {
    background-color: #fff;
  }
}
@media not print {
  #texteditor-backdrop #texteditor-container .CodeMirror-gutter,
  #texteditor-backdrop #texteditor-container .CodeMirror-gutters {
    background-color: #fff;
  }
}
@media not print {
  #texteditor-backdrop #texteditor-container {
    padding: 0px;
    background-color: #fff;
    -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
    box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  }
}
.CodeMirror-dialog {
  background-color: #fff;
}
/*!
*
* IPython notebook
*
*/
/* CSS font colors for translated ANSI escape sequences */
/* The color values are a mix of
   http://www.xcolors.net/dl/baskerville-ivorylight and
   http://www.xcolors.net/dl/euphrasia */
.ansi-black-fg {
  color: #3E424D;
}
.ansi-black-bg {
  background-color: #3E424D;
}
.ansi-black-intense-fg {
  color: #282C36;
}
.ansi-black-intense-bg {
  background-color: #282C36;
}
.ansi-red-fg {
  color: #E75C58;
}
.ansi-red-bg {
  background-color: #E75C58;
}
.ansi-red-intense-fg {
  color: #B22B31;
}
.ansi-red-intense-bg {
  background-color: #B22B31;
}
.ansi-green-fg {
  color: #00A250;
}
.ansi-green-bg {
  background-color: #00A250;
}
.ansi-green-intense-fg {
  color: #007427;
}
.ansi-green-intense-bg {
  background-color: #007427;
}
.ansi-yellow-fg {
  color: #DDB62B;
}
.ansi-yellow-bg {
  background-color: #DDB62B;
}
.ansi-yellow-intense-fg {
  color: #B27D12;
}
.ansi-yellow-intense-bg {
  background-color: #B27D12;
}
.ansi-blue-fg {
  color: #208FFB;
}
.ansi-blue-bg {
  background-color: #208FFB;
}
.ansi-blue-intense-fg {
  color: #0065CA;
}
.ansi-blue-intense-bg {
  background-color: #0065CA;
}
.ansi-magenta-fg {
  color: #D160C4;
}
.ansi-magenta-bg {
  background-color: #D160C4;
}
.ansi-magenta-intense-fg {
  color: #A03196;
}
.ansi-magenta-intense-bg {
  background-color: #A03196;
}
.ansi-cyan-fg {
  color: #60C6C8;
}
.ansi-cyan-bg {
  background-color: #60C6C8;
}
.ansi-cyan-intense-fg {
  color: #258F8F;
}
.ansi-cyan-intense-bg {
  background-color: #258F8F;
}
.ansi-white-fg {
  color: #C5C1B4;
}
.ansi-white-bg {
  background-color: #C5C1B4;
}
.ansi-white-intense-fg {
  color: #A1A6B2;
}
.ansi-white-intense-bg {
  background-color: #A1A6B2;
}
.ansi-default-inverse-fg {
  color: #FFFFFF;
}
.ansi-default-inverse-bg {
  background-color: #000000;
}
.ansi-bold {
  font-weight: bold;
}
.ansi-underline {
  text-decoration: underline;
}
/* The following styles are deprecated an will be removed in a future version */
.ansibold {
  font-weight: bold;
}
.ansi-inverse {
  outline: 0.5px dotted;
}
/* use dark versions for foreground, to improve visibility */
.ansiblack {
  color: black;
}
.ansired {
  color: darkred;
}
.ansigreen {
  color: darkgreen;
}
.ansiyellow {
  color: #c4a000;
}
.ansiblue {
  color: darkblue;
}
.ansipurple {
  color: darkviolet;
}
.ansicyan {
  color: steelblue;
}
.ansigray {
  color: gray;
}
/* and light for background, for the same reason */
.ansibgblack {
  background-color: black;
}
.ansibgred {
  background-color: red;
}
.ansibggreen {
  background-color: green;
}
.ansibgyellow {
  background-color: yellow;
}
.ansibgblue {
  background-color: blue;
}
.ansibgpurple {
  background-color: magenta;
}
.ansibgcyan {
  background-color: cyan;
}
.ansibggray {
  background-color: gray;
}
div.cell {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
  border-radius: 2px;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  border-width: 1px;
  border-style: solid;
  border-color: transparent;
  width: 100%;
  padding: 5px;
  /* This acts as a spacer between cells, that is outside the border */
  margin: 0px;
  outline: none;
  position: relative;
  overflow: visible;
}
div.cell:before {
  position: absolute;
  display: block;
  top: -1px;
  left: -1px;
  width: 5px;
  height: calc(100% +  2px);
  content: '';
  background: transparent;
}
div.cell.jupyter-soft-selected {
  border-left-color: #E3F2FD;
  border-left-width: 1px;
  padding-left: 5px;
  border-right-color: #E3F2FD;
  border-right-width: 1px;
  background: #E3F2FD;
}
@media print {
  div.cell.jupyter-soft-selected {
    border-color: transparent;
  }
}
div.cell.selected,
div.cell.selected.jupyter-soft-selected {
  border-color: #ababab;
}
div.cell.selected:before,
div.cell.selected.jupyter-soft-selected:before {
  position: absolute;
  display: block;
  top: -1px;
  left: -1px;
  width: 5px;
  height: calc(100% +  2px);
  content: '';
  background: #42A5F5;
}
@media print {
  div.cell.selected,
  div.cell.selected.jupyter-soft-selected {
    border-color: transparent;
  }
}
.edit_mode div.cell.selected {
  border-color: #66BB6A;
}
.edit_mode div.cell.selected:before {
  position: absolute;
  display: block;
  top: -1px;
  left: -1px;
  width: 5px;
  height: calc(100% +  2px);
  content: '';
  background: #66BB6A;
}
@media print {
  .edit_mode div.cell.selected {
    border-color: transparent;
  }
}
.prompt {
  /* This needs to be wide enough for 3 digit prompt numbers: In[100]: */
  min-width: 14ex;
  /* This padding is tuned to match the padding on the CodeMirror editor. */
  padding: 0.4em;
  margin: 0px;
  font-family: monospace;
  text-align: right;
  /* This has to match that of the the CodeMirror class line-height below */
  line-height: 1.21429em;
  /* Don't highlight prompt number selection */
  -webkit-touch-callout: none;
  -webkit-user-select: none;
  -khtml-user-select: none;
  -moz-user-select: none;
  -ms-user-select: none;
  user-select: none;
  /* Use default cursor */
  cursor: default;
}
@media (max-width: 540px) {
  .prompt {
    text-align: left;
  }
}
div.inner_cell {
  min-width: 0;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
  /* Old browsers */
  -webkit-box-flex: 1;
  -moz-box-flex: 1;
  box-flex: 1;
  /* Modern browsers */
  flex: 1;
}
/* input_area and input_prompt must match in top border and margin for alignment */
div.input_area {
  border: 1px solid #cfcfcf;
  border-radius: 2px;
  background: #f7f7f7;
  line-height: 1.21429em;
}
/* This is needed so that empty prompt areas can collapse to zero height when there
   is no content in the output_subarea and the prompt. The main purpose of this is
   to make sure that empty JavaScript output_subareas have no height. */
div.prompt:empty {
  padding-top: 0;
  padding-bottom: 0;
}
div.unrecognized_cell {
  padding: 5px 5px 5px 0px;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
}
div.unrecognized_cell .inner_cell {
  border-radius: 2px;
  padding: 5px;
  font-weight: bold;
  color: red;
  border: 1px solid #cfcfcf;
  background: #eaeaea;
}
div.unrecognized_cell .inner_cell a {
  color: inherit;
  text-decoration: none;
}
div.unrecognized_cell .inner_cell a:hover {
  color: inherit;
  text-decoration: none;
}
@media (max-width: 540px) {
  div.unrecognized_cell > div.prompt {
    display: none;
  }
}
div.code_cell {
  /* avoid page breaking on code cells when printing */
}
@media print {
  div.code_cell {
    page-break-inside: avoid;
  }
}
/* any special styling for code cells that are currently running goes here */
div.input {
  page-break-inside: avoid;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
}
@media (max-width: 540px) {
  div.input {
    /* Old browsers */
    display: -webkit-box;
    -webkit-box-orient: vertical;
    -webkit-box-align: stretch;
    display: -moz-box;
    -moz-box-orient: vertical;
    -moz-box-align: stretch;
    display: box;
    box-orient: vertical;
    box-align: stretch;
    /* Modern browsers */
    display: flex;
    flex-direction: column;
    align-items: stretch;
  }
}
/* input_area and input_prompt must match in top border and margin for alignment */
div.input_prompt {
  color: #303F9F;
  border-top: 1px solid transparent;
}
div.input_area > div.highlight {
  margin: 0.4em;
  border: none;
  padding: 0px;
  background-color: transparent;
}
div.input_area > div.highlight > pre {
  margin: 0px;
  border: none;
  padding: 0px;
  background-color: transparent;
}
/* The following gets added to the <head> if it is detected that the user has a
 * monospace font with inconsistent normal/bold/italic height.  See
 * notebookmain.js.  Such fonts will have keywords vertically offset with
 * respect to the rest of the text.  The user should select a better font.
 * See: https://github.com/ipython/ipython/issues/1503
 *
 * .CodeMirror span {
 *      vertical-align: bottom;
 * }
 */
.CodeMirror {
  line-height: 1.21429em;
  /* Changed from 1em to our global default */
  font-size: 14px;
  height: auto;
  /* Changed to auto to autogrow */
  background: none;
  /* Changed from white to allow our bg to show through */
}
.CodeMirror-scroll {
  /*  The CodeMirror docs are a bit fuzzy on if overflow-y should be hidden or visible.*/
  /*  We have found that if it is visible, vertical scrollbars appear with font size changes.*/
  overflow-y: hidden;
  overflow-x: auto;
}
.CodeMirror-lines {
  /* In CM2, this used to be 0.4em, but in CM3 it went to 4px. We need the em value because */
  /* we have set a different line-height and want this to scale with that. */
  /* Note that this should set vertical padding only, since CodeMirror assumes
       that horizontal padding will be set on CodeMirror pre */
  padding: 0.4em 0;
}
.CodeMirror-linenumber {
  padding: 0 8px 0 4px;
}
.CodeMirror-gutters {
  border-bottom-left-radius: 2px;
  border-top-left-radius: 2px;
}
.CodeMirror pre {
  /* In CM3 this went to 4px from 0 in CM2. This sets horizontal padding only,
    use .CodeMirror-lines for vertical */
  padding: 0 0.4em;
  border: 0;
  border-radius: 0;
}
.CodeMirror-cursor {
  border-left: 1.4px solid black;
}
@media screen and (min-width: 2138px) and (max-width: 4319px) {
  .CodeMirror-cursor {
    border-left: 2px solid black;
  }
}
@media screen and (min-width: 4320px) {
  .CodeMirror-cursor {
    border-left: 4px solid black;
  }
}
/*

Original style from softwaremaniacs.org (c) Ivan Sagalaev <Maniac@SoftwareManiacs.Org>
Adapted from GitHub theme

*/
.highlight-base {
  color: #000;
}
.highlight-variable {
  color: #000;
}
.highlight-variable-2 {
  color: #1a1a1a;
}
.highlight-variable-3 {
  color: #333333;
}
.highlight-string {
  color: #BA2121;
}
.highlight-comment {
  color: #408080;
  font-style: italic;
}
.highlight-number {
  color: #080;
}
.highlight-atom {
  color: #88F;
}
.highlight-keyword {
  color: #008000;
  font-weight: bold;
}
.highlight-builtin {
  color: #008000;
}
.highlight-error {
  color: #f00;
}
.highlight-operator {
  color: #AA22FF;
  font-weight: bold;
}
.highlight-meta {
  color: #AA22FF;
}
/* previously not defined, copying from default codemirror */
.highlight-def {
  color: #00f;
}
.highlight-string-2 {
  color: #f50;
}
.highlight-qualifier {
  color: #555;
}
.highlight-bracket {
  color: #997;
}
.highlight-tag {
  color: #170;
}
.highlight-attribute {
  color: #00c;
}
.highlight-header {
  color: blue;
}
.highlight-quote {
  color: #090;
}
.highlight-link {
  color: #00c;
}
/* apply the same style to codemirror */
.cm-s-ipython span.cm-keyword {
  color: #008000;
  font-weight: bold;
}
.cm-s-ipython span.cm-atom {
  color: #88F;
}
.cm-s-ipython span.cm-number {
  color: #080;
}
.cm-s-ipython span.cm-def {
  color: #00f;
}
.cm-s-ipython span.cm-variable {
  color: #000;
}
.cm-s-ipython span.cm-operator {
  color: #AA22FF;
  font-weight: bold;
}
.cm-s-ipython span.cm-variable-2 {
  color: #1a1a1a;
}
.cm-s-ipython span.cm-variable-3 {
  color: #333333;
}
.cm-s-ipython span.cm-comment {
  color: #408080;
  font-style: italic;
}
.cm-s-ipython span.cm-string {
  color: #BA2121;
}
.cm-s-ipython span.cm-string-2 {
  color: #f50;
}
.cm-s-ipython span.cm-meta {
  color: #AA22FF;
}
.cm-s-ipython span.cm-qualifier {
  color: #555;
}
.cm-s-ipython span.cm-builtin {
  color: #008000;
}
.cm-s-ipython span.cm-bracket {
  color: #997;
}
.cm-s-ipython span.cm-tag {
  color: #170;
}
.cm-s-ipython span.cm-attribute {
  color: #00c;
}
.cm-s-ipython span.cm-header {
  color: blue;
}
.cm-s-ipython span.cm-quote {
  color: #090;
}
.cm-s-ipython span.cm-link {
  color: #00c;
}
.cm-s-ipython span.cm-error {
  color: #f00;
}
.cm-s-ipython span.cm-tab {
  background: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAADAAAAAMCAYAAAAkuj5RAAAAAXNSR0IArs4c6QAAAGFJREFUSMft1LsRQFAQheHPowAKoACx3IgEKtaEHujDjORSgWTH/ZOdnZOcM/sgk/kFFWY0qV8foQwS4MKBCS3qR6ixBJvElOobYAtivseIE120FaowJPN75GMu8j/LfMwNjh4HUpwg4LUAAAAASUVORK5CYII=);
  background-position: right;
  background-repeat: no-repeat;
}
div.output_wrapper {
  /* this position must be relative to enable descendents to be absolute within it */
  position: relative;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
  z-index: 1;
}
/* class for the output area when it should be height-limited */
div.output_scroll {
  /* ideally, this would be max-height, but FF barfs all over that */
  height: 24em;
  /* FF needs this *and the wrapper* to specify full width, or it will shrinkwrap */
  width: 100%;
  overflow: auto;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 2px 8px rgba(0, 0, 0, 0.8);
  box-shadow: inset 0 2px 8px rgba(0, 0, 0, 0.8);
  display: block;
}
/* output div while it is collapsed */
div.output_collapsed {
  margin: 0px;
  padding: 0px;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
}
div.out_prompt_overlay {
  height: 100%;
  padding: 0px 0.4em;
  position: absolute;
  border-radius: 2px;
}
div.out_prompt_overlay:hover {
  /* use inner shadow to get border that is computed the same on WebKit/FF */
  -webkit-box-shadow: inset 0 0 1px #000;
  box-shadow: inset 0 0 1px #000;
  background: rgba(240, 240, 240, 0.5);
}
div.output_prompt {
  color: #D84315;
}
/* This class is the outer container of all output sections. */
div.output_area {
  padding: 0px;
  page-break-inside: avoid;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
}
div.output_area .MathJax_Display {
  text-align: left !important;
}
div.output_area .rendered_html table {
  margin-left: 0;
  margin-right: 0;
}
div.output_area .rendered_html img {
  margin-left: 0;
  margin-right: 0;
}
div.output_area img,
div.output_area svg {
  max-width: 100%;
  height: auto;
}
div.output_area img.unconfined,
div.output_area svg.unconfined {
  max-width: none;
}
div.output_area .mglyph > img {
  max-width: none;
}
/* This is needed to protect the pre formating from global settings such
   as that of bootstrap */
.output {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
}
@media (max-width: 540px) {
  div.output_area {
    /* Old browsers */
    display: -webkit-box;
    -webkit-box-orient: vertical;
    -webkit-box-align: stretch;
    display: -moz-box;
    -moz-box-orient: vertical;
    -moz-box-align: stretch;
    display: box;
    box-orient: vertical;
    box-align: stretch;
    /* Modern browsers */
    display: flex;
    flex-direction: column;
    align-items: stretch;
  }
}
div.output_area pre {
  margin: 0;
  padding: 1px 0 1px 0;
  border: 0;
  vertical-align: baseline;
  color: black;
  background-color: transparent;
  border-radius: 0;
}
/* This class is for the output subarea inside the output_area and after
   the prompt div. */
div.output_subarea {
  overflow-x: auto;
  padding: 0.4em;
  /* Old browsers */
  -webkit-box-flex: 1;
  -moz-box-flex: 1;
  box-flex: 1;
  /* Modern browsers */
  flex: 1;
  max-width: calc(100% - 14ex);
}
div.output_scroll div.output_subarea {
  overflow-x: visible;
}
/* The rest of the output_* classes are for special styling of the different
   output types */
/* all text output has this class: */
div.output_text {
  text-align: left;
  color: #000;
  /* This has to match that of the the CodeMirror class line-height below */
  line-height: 1.21429em;
}
/* stdout/stderr are 'text' as well as 'stream', but execute_result/error are *not* streams */
div.output_stderr {
  background: #fdd;
  /* very light red background for stderr */
}
div.output_latex {
  text-align: left;
}
/* Empty output_javascript divs should have no height */
div.output_javascript:empty {
  padding: 0;
}
.js-error {
  color: darkred;
}
/* raw_input styles */
div.raw_input_container {
  line-height: 1.21429em;
  padding-top: 5px;
}
pre.raw_input_prompt {
  /* nothing needed here. */
}
input.raw_input {
  font-family: monospace;
  font-size: inherit;
  color: inherit;
  width: auto;
  /* make sure input baseline aligns with prompt */
  vertical-align: baseline;
  /* padding + margin = 0.5em between prompt and cursor */
  padding: 0em 0.25em;
  margin: 0em 0.25em;
}
input.raw_input:focus {
  box-shadow: none;
}
p.p-space {
  margin-bottom: 10px;
}
div.output_unrecognized {
  padding: 5px;
  font-weight: bold;
  color: red;
}
div.output_unrecognized a {
  color: inherit;
  text-decoration: none;
}
div.output_unrecognized a:hover {
  color: inherit;
  text-decoration: none;
}
.rendered_html {
  color: #000;
  /* any extras will just be numbers: */
}
.rendered_html em {
  font-style: italic;
}
.rendered_html strong {
  font-weight: bold;
}
.rendered_html u {
  text-decoration: underline;
}
.rendered_html :link {
  text-decoration: underline;
}
.rendered_html :visited {
  text-decoration: underline;
}
.rendered_html h1 {
  font-size: 185.7%;
  margin: 1.08em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
}
.rendered_html h2 {
  font-size: 157.1%;
  margin: 1.27em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
}
.rendered_html h3 {
  font-size: 128.6%;
  margin: 1.55em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
}
.rendered_html h4 {
  font-size: 100%;
  margin: 2em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
}
.rendered_html h5 {
  font-size: 100%;
  margin: 2em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
  font-style: italic;
}
.rendered_html h6 {
  font-size: 100%;
  margin: 2em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
  font-style: italic;
}
.rendered_html h1:first-child {
  margin-top: 0.538em;
}
.rendered_html h2:first-child {
  margin-top: 0.636em;
}
.rendered_html h3:first-child {
  margin-top: 0.777em;
}
.rendered_html h4:first-child {
  margin-top: 1em;
}
.rendered_html h5:first-child {
  margin-top: 1em;
}
.rendered_html h6:first-child {
  margin-top: 1em;
}
.rendered_html ul:not(.list-inline),
.rendered_html ol:not(.list-inline) {
  padding-left: 2em;
}
.rendered_html ul {
  list-style: disc;
}
.rendered_html ul ul {
  list-style: square;
  margin-top: 0;
}
.rendered_html ul ul ul {
  list-style: circle;
}
.rendered_html ol {
  list-style: decimal;
}
.rendered_html ol ol {
  list-style: upper-alpha;
  margin-top: 0;
}
.rendered_html ol ol ol {
  list-style: lower-alpha;
}
.rendered_html ol ol ol ol {
  list-style: lower-roman;
}
.rendered_html ol ol ol ol ol {
  list-style: decimal;
}
.rendered_html * + ul {
  margin-top: 1em;
}
.rendered_html * + ol {
  margin-top: 1em;
}
.rendered_html hr {
  color: black;
  background-color: black;
}
.rendered_html pre {
  margin: 1em 2em;
  padding: 0px;
  background-color: #fff;
}
.rendered_html code {
  background-color: #eff0f1;
}
.rendered_html p code {
  padding: 1px 5px;
}
.rendered_html pre code {
  background-color: #fff;
}
.rendered_html pre,
.rendered_html code {
  border: 0;
  color: #000;
  font-size: 100%;
}
.rendered_html blockquote {
  margin: 1em 2em;
}
.rendered_html table {
  margin-left: auto;
  margin-right: auto;
  border: none;
  border-collapse: collapse;
  border-spacing: 0;
  color: black;
  font-size: 12px;
  table-layout: fixed;
}
.rendered_html thead {
  border-bottom: 1px solid black;
  vertical-align: bottom;
}
.rendered_html tr,
.rendered_html th,
.rendered_html td {
  text-align: right;
  vertical-align: middle;
  padding: 0.5em 0.5em;
  line-height: normal;
  white-space: normal;
  max-width: none;
  border: none;
}
.rendered_html th {
  font-weight: bold;
}
.rendered_html tbody tr:nth-child(odd) {
  background: #f5f5f5;
}
.rendered_html tbody tr:hover {
  background: rgba(66, 165, 245, 0.2);
}
.rendered_html * + table {
  margin-top: 1em;
}
.rendered_html p {
  text-align: left;
}
.rendered_html * + p {
  margin-top: 1em;
}
.rendered_html img {
  display: block;
  margin-left: auto;
  margin-right: auto;
}
.rendered_html * + img {
  margin-top: 1em;
}
.rendered_html img,
.rendered_html svg {
  max-width: 100%;
  height: auto;
}
.rendered_html img.unconfined,
.rendered_html svg.unconfined {
  max-width: none;
}
.rendered_html .alert {
  margin-bottom: initial;
}
.rendered_html * + .alert {
  margin-top: 1em;
}
[dir="rtl"] .rendered_html p {
  text-align: right;
}
div.text_cell {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
}
@media (max-width: 540px) {
  div.text_cell > div.prompt {
    display: none;
  }
}
div.text_cell_render {
  /*font-family: "Helvetica Neue", Arial, Helvetica, Geneva, sans-serif;*/
  outline: none;
  resize: none;
  width: inherit;
  border-style: none;
  padding: 0.5em 0.5em 0.5em 0.4em;
  color: #000;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
}
a.anchor-link:link {
  text-decoration: none;
  padding: 0px 20px;
  visibility: hidden;
}
h1:hover .anchor-link,
h2:hover .anchor-link,
h3:hover .anchor-link,
h4:hover .anchor-link,
h5:hover .anchor-link,
h6:hover .anchor-link {
  visibility: visible;
}
.text_cell.rendered .input_area {
  display: none;
}
.text_cell.rendered .rendered_html {
  overflow-x: auto;
  overflow-y: hidden;
}
.text_cell.rendered .rendered_html tr,
.text_cell.rendered .rendered_html th,
.text_cell.rendered .rendered_html td {
  max-width: none;
}
.text_cell.unrendered .text_cell_render {
  display: none;
}
.text_cell .dropzone .input_area {
  border: 2px dashed #bababa;
  margin: -1px;
}
.cm-header-1,
.cm-header-2,
.cm-header-3,
.cm-header-4,
.cm-header-5,
.cm-header-6 {
  font-weight: bold;
  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
}
.cm-header-1 {
  font-size: 185.7%;
}
.cm-header-2 {
  font-size: 157.1%;
}
.cm-header-3 {
  font-size: 128.6%;
}
.cm-header-4 {
  font-size: 110%;
}
.cm-header-5 {
  font-size: 100%;
  font-style: italic;
}
.cm-header-6 {
  font-size: 100%;
  font-style: italic;
}
/*!
*
* IPython notebook webapp
*
*/
@media (max-width: 767px) {
  .notebook_app {
    padding-left: 0px;
    padding-right: 0px;
  }
}
#ipython-main-app {
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  height: 100%;
}
div#notebook_panel {
  margin: 0px;
  padding: 0px;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  height: 100%;
}
div#notebook {
  font-size: 14px;
  line-height: 20px;
  overflow-y: hidden;
  overflow-x: auto;
  width: 100%;
  /* This spaces the page away from the edge of the notebook area */
  padding-top: 20px;
  margin: 0px;
  outline: none;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  min-height: 100%;
}
@media not print {
  #notebook-container {
    padding: 15px;
    background-color: #fff;
    min-height: 0;
    -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
    box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  }
}
@media print {
  #notebook-container {
    width: 100%;
  }
}
div.ui-widget-content {
  border: 1px solid #ababab;
  outline: none;
}
pre.dialog {
  background-color: #f7f7f7;
  border: 1px solid #ddd;
  border-radius: 2px;
  padding: 0.4em;
  padding-left: 2em;
}
p.dialog {
  padding: 0.2em;
}
/* Word-wrap output correctly.  This is the CSS3 spelling, though Firefox seems
   to not honor it correctly.  Webkit browsers (Chrome, rekonq, Safari) do.
 */
pre,
code,
kbd,
samp {
  white-space: pre-wrap;
}
#fonttest {
  font-family: monospace;
}
p {
  margin-bottom: 0;
}
.end_space {
  min-height: 100px;
  transition: height .2s ease;
}
.notebook_app > #header {
  -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
}
@media not print {
  .notebook_app {
    background-color: #EEE;
  }
}
kbd {
  border-style: solid;
  border-width: 1px;
  box-shadow: none;
  margin: 2px;
  padding-left: 2px;
  padding-right: 2px;
  padding-top: 1px;
  padding-bottom: 1px;
}
.jupyter-keybindings {
  padding: 1px;
  line-height: 24px;
  border-bottom: 1px solid gray;
}
.jupyter-keybindings input {
  margin: 0;
  padding: 0;
  border: none;
}
.jupyter-keybindings i {
  padding: 6px;
}
.well code {
  background-color: #ffffff;
  border-color: #ababab;
  border-width: 1px;
  border-style: solid;
  padding: 2px;
  padding-top: 1px;
  padding-bottom: 1px;
}
/* CSS for the cell toolbar */
.celltoolbar {
  border: thin solid #CFCFCF;
  border-bottom: none;
  background: #EEE;
  border-radius: 2px 2px 0px 0px;
  width: 100%;
  height: 29px;
  padding-right: 4px;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
  /* Old browsers */
  -webkit-box-pack: end;
  -moz-box-pack: end;
  box-pack: end;
  /* Modern browsers */
  justify-content: flex-end;
  display: -webkit-flex;
}
@media print {
  .celltoolbar {
    display: none;
  }
}
.ctb_hideshow {
  display: none;
  vertical-align: bottom;
}
/* ctb_show is added to the ctb_hideshow div to show the cell toolbar.
   Cell toolbars are only shown when the ctb_global_show class is also set.
*/
.ctb_global_show .ctb_show.ctb_hideshow {
  display: block;
}
.ctb_global_show .ctb_show + .input_area,
.ctb_global_show .ctb_show + div.text_cell_input,
.ctb_global_show .ctb_show ~ div.text_cell_render {
  border-top-right-radius: 0px;
  border-top-left-radius: 0px;
}
.ctb_global_show .ctb_show ~ div.text_cell_render {
  border: 1px solid #cfcfcf;
}
.celltoolbar {
  font-size: 87%;
  padding-top: 3px;
}
.celltoolbar select {
  display: block;
  width: 100%;
  height: 32px;
  padding: 6px 12px;
  font-size: 13px;
  line-height: 1.42857143;
  color: #555555;
  background-color: #fff;
  background-image: none;
  border: 1px solid #ccc;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  -webkit-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  -o-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  height: 30px;
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
  width: inherit;
  font-size: inherit;
  height: 22px;
  padding: 0px;
  display: inline-block;
}
.celltoolbar select:focus {
  border-color: #66afe9;
  outline: 0;
  -webkit-box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, 0.6);
  box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, 0.6);
}
.celltoolbar select::-moz-placeholder {
  color: #999;
  opacity: 1;
}
.celltoolbar select:-ms-input-placeholder {
  color: #999;
}
.celltoolbar select::-webkit-input-placeholder {
  color: #999;
}
.celltoolbar select::-ms-expand {
  border: 0;
  background-color: transparent;
}
.celltoolbar select[disabled],
.celltoolbar select[readonly],
fieldset[disabled] .celltoolbar select {
  background-color: #eeeeee;
  opacity: 1;
}
.celltoolbar select[disabled],
fieldset[disabled] .celltoolbar select {
  cursor: not-allowed;
}
textarea.celltoolbar select {
  height: auto;
}
select.celltoolbar select {
  height: 30px;
  line-height: 30px;
}
textarea.celltoolbar select,
select[multiple].celltoolbar select {
  height: auto;
}
.celltoolbar label {
  margin-left: 5px;
  margin-right: 5px;
}
.tags_button_container {
  width: 100%;
  display: flex;
}
.tag-container {
  display: flex;
  flex-direction: row;
  flex-grow: 1;
  overflow: hidden;
  position: relative;
}
.tag-container > * {
  margin: 0 4px;
}
.remove-tag-btn {
  margin-left: 4px;
}
.tags-input {
  display: flex;
}
.cell-tag:last-child:after {
  content: "";
  position: absolute;
  right: 0;
  width: 40px;
  height: 100%;
  /* Fade to background color of cell toolbar */
  background: linear-gradient(to right, rgba(0, 0, 0, 0), #EEE);
}
.tags-input > * {
  margin-left: 4px;
}
.cell-tag,
.tags-input input,
.tags-input button {
  display: block;
  width: 100%;
  height: 32px;
  padding: 6px 12px;
  font-size: 13px;
  line-height: 1.42857143;
  color: #555555;
  background-color: #fff;
  background-image: none;
  border: 1px solid #ccc;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  -webkit-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  -o-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  height: 30px;
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
  box-shadow: none;
  width: inherit;
  font-size: inherit;
  height: 22px;
  line-height: 22px;
  padding: 0px 4px;
  display: inline-block;
}
.cell-tag:focus,
.tags-input input:focus,
.tags-input button:focus {
  border-color: #66afe9;
  outline: 0;
  -webkit-box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, 0.6);
  box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, 0.6);
}
.cell-tag::-moz-placeholder,
.tags-input input::-moz-placeholder,
.tags-input button::-moz-placeholder {
  color: #999;
  opacity: 1;
}
.cell-tag:-ms-input-placeholder,
.tags-input input:-ms-input-placeholder,
.tags-input button:-ms-input-placeholder {
  color: #999;
}
.cell-tag::-webkit-input-placeholder,
.tags-input input::-webkit-input-placeholder,
.tags-input button::-webkit-input-placeholder {
  color: #999;
}
.cell-tag::-ms-expand,
.tags-input input::-ms-expand,
.tags-input button::-ms-expand {
  border: 0;
  background-color: transparent;
}
.cell-tag[disabled],
.tags-input input[disabled],
.tags-input button[disabled],
.cell-tag[readonly],
.tags-input input[readonly],
.tags-input button[readonly],
fieldset[disabled] .cell-tag,
fieldset[disabled] .tags-input input,
fieldset[disabled] .tags-input button {
  background-color: #eeeeee;
  opacity: 1;
}
.cell-tag[disabled],
.tags-input input[disabled],
.tags-input button[disabled],
fieldset[disabled] .cell-tag,
fieldset[disabled] .tags-input input,
fieldset[disabled] .tags-input button {
  cursor: not-allowed;
}
textarea.cell-tag,
textarea.tags-input input,
textarea.tags-input button {
  height: auto;
}
select.cell-tag,
select.tags-input input,
select.tags-input button {
  height: 30px;
  line-height: 30px;
}
textarea.cell-tag,
textarea.tags-input input,
textarea.tags-input button,
select[multiple].cell-tag,
select[multiple].tags-input input,
select[multiple].tags-input button {
  height: auto;
}
.cell-tag,
.tags-input button {
  padding: 0px 4px;
}
.cell-tag {
  background-color: #fff;
  white-space: nowrap;
}
.tags-input input[type=text]:focus {
  outline: none;
  box-shadow: none;
  border-color: #ccc;
}
.completions {
  position: absolute;
  z-index: 110;
  overflow: hidden;
  border: 1px solid #ababab;
  border-radius: 2px;
  -webkit-box-shadow: 0px 6px 10px -1px #adadad;
  box-shadow: 0px 6px 10px -1px #adadad;
  line-height: 1;
}
.completions select {
  background: white;
  outline: none;
  border: none;
  padding: 0px;
  margin: 0px;
  overflow: auto;
  font-family: monospace;
  font-size: 110%;
  color: #000;
  width: auto;
}
.completions select option.context {
  color: #286090;
}
#kernel_logo_widget .current_kernel_logo {
  display: none;
  margin-top: -1px;
  margin-bottom: -1px;
  width: 32px;
  height: 32px;
}
[dir="rtl"] #kernel_logo_widget {
  float: left !important;
  float: left;
}
.modal .modal-body .move-path {
  display: flex;
  flex-direction: row;
  justify-content: space;
  align-items: center;
}
.modal .modal-body .move-path .server-root {
  padding-right: 20px;
}
.modal .modal-body .move-path .path-input {
  flex: 1;
}
#menubar {
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  margin-top: 1px;
}
#menubar .navbar {
  border-top: 1px;
  border-radius: 0px 0px 2px 2px;
  margin-bottom: 0px;
}
#menubar .navbar-toggle {
  float: left;
  padding-top: 7px;
  padding-bottom: 7px;
  border: none;
}
#menubar .navbar-collapse {
  clear: left;
}
[dir="rtl"] #menubar .navbar-toggle {
  float: right;
}
[dir="rtl"] #menubar .navbar-collapse {
  clear: right;
}
[dir="rtl"] #menubar .navbar-nav {
  float: right;
}
[dir="rtl"] #menubar .nav {
  padding-right: 0px;
}
[dir="rtl"] #menubar .navbar-nav > li {
  float: right;
}
[dir="rtl"] #menubar .navbar-right {
  float: left !important;
}
[dir="rtl"] ul.dropdown-menu {
  text-align: right;
  left: auto;
}
[dir="rtl"] ul#new-menu.dropdown-menu {
  right: auto;
  left: 0;
}
.nav-wrapper {
  border-bottom: 1px solid #e7e7e7;
}
i.menu-icon {
  padding-top: 4px;
}
[dir="rtl"] i.menu-icon.pull-right {
  float: left !important;
  float: left;
}
ul#help_menu li a {
  overflow: hidden;
  padding-right: 2.2em;
}
ul#help_menu li a i {
  margin-right: -1.2em;
}
[dir="rtl"] ul#help_menu li a {
  padding-left: 2.2em;
}
[dir="rtl"] ul#help_menu li a i {
  margin-right: 0;
  margin-left: -1.2em;
}
[dir="rtl"] ul#help_menu li a i.pull-right {
  float: left !important;
  float: left;
}
.dropdown-submenu {
  position: relative;
}
.dropdown-submenu > .dropdown-menu {
  top: 0;
  left: 100%;
  margin-top: -6px;
  margin-left: -1px;
}
[dir="rtl"] .dropdown-submenu > .dropdown-menu {
  right: 100%;
  margin-right: -1px;
}
.dropdown-submenu:hover > .dropdown-menu {
  display: block;
}
.dropdown-submenu > a:after {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  display: block;
  content: "\f0da";
  float: right;
  color: #333333;
  margin-top: 2px;
  margin-right: -10px;
}
.dropdown-submenu > a:after.fa-pull-left {
  margin-right: .3em;
}
.dropdown-submenu > a:after.fa-pull-right {
  margin-left: .3em;
}
.dropdown-submenu > a:after.pull-left {
  margin-right: .3em;
}
.dropdown-submenu > a:after.pull-right {
  margin-left: .3em;
}
[dir="rtl"] .dropdown-submenu > a:after {
  float: left;
  content: "\f0d9";
  margin-right: 0;
  margin-left: -10px;
}
.dropdown-submenu:hover > a:after {
  color: #262626;
}
.dropdown-submenu.pull-left {
  float: none;
}
.dropdown-submenu.pull-left > .dropdown-menu {
  left: -100%;
  margin-left: 10px;
}
#notification_area {
  float: right !important;
  float: right;
  z-index: 10;
}
[dir="rtl"] #notification_area {
  float: left !important;
  float: left;
}
.indicator_area {
  float: right !important;
  float: right;
  color: #777;
  margin-left: 5px;
  margin-right: 5px;
  width: 11px;
  z-index: 10;
  text-align: center;
  width: auto;
}
[dir="rtl"] .indicator_area {
  float: left !important;
  float: left;
}
#kernel_indicator {
  float: right !important;
  float: right;
  color: #777;
  margin-left: 5px;
  margin-right: 5px;
  width: 11px;
  z-index: 10;
  text-align: center;
  width: auto;
  border-left: 1px solid;
}
#kernel_indicator .kernel_indicator_name {
  padding-left: 5px;
  padding-right: 5px;
}
[dir="rtl"] #kernel_indicator {
  float: left !important;
  float: left;
  border-left: 0;
  border-right: 1px solid;
}
#modal_indicator {
  float: right !important;
  float: right;
  color: #777;
  margin-left: 5px;
  margin-right: 5px;
  width: 11px;
  z-index: 10;
  text-align: center;
  width: auto;
}
[dir="rtl"] #modal_indicator {
  float: left !important;
  float: left;
}
#readonly-indicator {
  float: right !important;
  float: right;
  color: #777;
  margin-left: 5px;
  margin-right: 5px;
  width: 11px;
  z-index: 10;
  text-align: center;
  width: auto;
  margin-top: 2px;
  margin-bottom: 0px;
  margin-left: 0px;
  margin-right: 0px;
  display: none;
}
.modal_indicator:before {
  width: 1.28571429em;
  text-align: center;
}
.edit_mode .modal_indicator:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f040";
}
.edit_mode .modal_indicator:before.fa-pull-left {
  margin-right: .3em;
}
.edit_mode .modal_indicator:before.fa-pull-right {
  margin-left: .3em;
}
.edit_mode .modal_indicator:before.pull-left {
  margin-right: .3em;
}
.edit_mode .modal_indicator:before.pull-right {
  margin-left: .3em;
}
.command_mode .modal_indicator:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: ' ';
}
.command_mode .modal_indicator:before.fa-pull-left {
  margin-right: .3em;
}
.command_mode .modal_indicator:before.fa-pull-right {
  margin-left: .3em;
}
.command_mode .modal_indicator:before.pull-left {
  margin-right: .3em;
}
.command_mode .modal_indicator:before.pull-right {
  margin-left: .3em;
}
.kernel_idle_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f10c";
}
.kernel_idle_icon:before.fa-pull-left {
  margin-right: .3em;
}
.kernel_idle_icon:before.fa-pull-right {
  margin-left: .3em;
}
.kernel_idle_icon:before.pull-left {
  margin-right: .3em;
}
.kernel_idle_icon:before.pull-right {
  margin-left: .3em;
}
.kernel_busy_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f111";
}
.kernel_busy_icon:before.fa-pull-left {
  margin-right: .3em;
}
.kernel_busy_icon:before.fa-pull-right {
  margin-left: .3em;
}
.kernel_busy_icon:before.pull-left {
  margin-right: .3em;
}
.kernel_busy_icon:before.pull-right {
  margin-left: .3em;
}
.kernel_dead_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f1e2";
}
.kernel_dead_icon:before.fa-pull-left {
  margin-right: .3em;
}
.kernel_dead_icon:before.fa-pull-right {
  margin-left: .3em;
}
.kernel_dead_icon:before.pull-left {
  margin-right: .3em;
}
.kernel_dead_icon:before.pull-right {
  margin-left: .3em;
}
.kernel_disconnected_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f127";
}
.kernel_disconnected_icon:before.fa-pull-left {
  margin-right: .3em;
}
.kernel_disconnected_icon:before.fa-pull-right {
  margin-left: .3em;
}
.kernel_disconnected_icon:before.pull-left {
  margin-right: .3em;
}
.kernel_disconnected_icon:before.pull-right {
  margin-left: .3em;
}
.notification_widget {
  color: #777;
  z-index: 10;
  background: rgba(240, 240, 240, 0.5);
  margin-right: 4px;
  color: #333;
  background-color: #fff;
  border-color: #ccc;
}
.notification_widget:focus,
.notification_widget.focus {
  color: #333;
  background-color: #e6e6e6;
  border-color: #8c8c8c;
}
.notification_widget:hover {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
.notification_widget:active,
.notification_widget.active,
.open > .dropdown-toggle.notification_widget {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
.notification_widget:active:hover,
.notification_widget.active:hover,
.open > .dropdown-toggle.notification_widget:hover,
.notification_widget:active:focus,
.notification_widget.active:focus,
.open > .dropdown-toggle.notification_widget:focus,
.notification_widget:active.focus,
.notification_widget.active.focus,
.open > .dropdown-toggle.notification_widget.focus {
  color: #333;
  background-color: #d4d4d4;
  border-color: #8c8c8c;
}
.notification_widget:active,
.notification_widget.active,
.open > .dropdown-toggle.notification_widget {
  background-image: none;
}
.notification_widget.disabled:hover,
.notification_widget[disabled]:hover,
fieldset[disabled] .notification_widget:hover,
.notification_widget.disabled:focus,
.notification_widget[disabled]:focus,
fieldset[disabled] .notification_widget:focus,
.notification_widget.disabled.focus,
.notification_widget[disabled].focus,
fieldset[disabled] .notification_widget.focus {
  background-color: #fff;
  border-color: #ccc;
}
.notification_widget .badge {
  color: #fff;
  background-color: #333;
}
.notification_widget.warning {
  color: #fff;
  background-color: #f0ad4e;
  border-color: #eea236;
}
.notification_widget.warning:focus,
.notification_widget.warning.focus {
  color: #fff;
  background-color: #ec971f;
  border-color: #985f0d;
}
.notification_widget.warning:hover {
  color: #fff;
  background-color: #ec971f;
  border-color: #d58512;
}
.notification_widget.warning:active,
.notification_widget.warning.active,
.open > .dropdown-toggle.notification_widget.warning {
  color: #fff;
  background-color: #ec971f;
  border-color: #d58512;
}
.notification_widget.warning:active:hover,
.notification_widget.warning.active:hover,
.open > .dropdown-toggle.notification_widget.warning:hover,
.notification_widget.warning:active:focus,
.notification_widget.warning.active:focus,
.open > .dropdown-toggle.notification_widget.warning:focus,
.notification_widget.warning:active.focus,
.notification_widget.warning.active.focus,
.open > .dropdown-toggle.notification_widget.warning.focus {
  color: #fff;
  background-color: #d58512;
  border-color: #985f0d;
}
.notification_widget.warning:active,
.notification_widget.warning.active,
.open > .dropdown-toggle.notification_widget.warning {
  background-image: none;
}
.notification_widget.warning.disabled:hover,
.notification_widget.warning[disabled]:hover,
fieldset[disabled] .notification_widget.warning:hover,
.notification_widget.warning.disabled:focus,
.notification_widget.warning[disabled]:focus,
fieldset[disabled] .notification_widget.warning:focus,
.notification_widget.warning.disabled.focus,
.notification_widget.warning[disabled].focus,
fieldset[disabled] .notification_widget.warning.focus {
  background-color: #f0ad4e;
  border-color: #eea236;
}
.notification_widget.warning .badge {
  color: #f0ad4e;
  background-color: #fff;
}
.notification_widget.success {
  color: #fff;
  background-color: #5cb85c;
  border-color: #4cae4c;
}
.notification_widget.success:focus,
.notification_widget.success.focus {
  color: #fff;
  background-color: #449d44;
  border-color: #255625;
}
.notification_widget.success:hover {
  color: #fff;
  background-color: #449d44;
  border-color: #398439;
}
.notification_widget.success:active,
.notification_widget.success.active,
.open > .dropdown-toggle.notification_widget.success {
  color: #fff;
  background-color: #449d44;
  border-color: #398439;
}
.notification_widget.success:active:hover,
.notification_widget.success.active:hover,
.open > .dropdown-toggle.notification_widget.success:hover,
.notification_widget.success:active:focus,
.notification_widget.success.active:focus,
.open > .dropdown-toggle.notification_widget.success:focus,
.notification_widget.success:active.focus,
.notification_widget.success.active.focus,
.open > .dropdown-toggle.notification_widget.success.focus {
  color: #fff;
  background-color: #398439;
  border-color: #255625;
}
.notification_widget.success:active,
.notification_widget.success.active,
.open > .dropdown-toggle.notification_widget.success {
  background-image: none;
}
.notification_widget.success.disabled:hover,
.notification_widget.success[disabled]:hover,
fieldset[disabled] .notification_widget.success:hover,
.notification_widget.success.disabled:focus,
.notification_widget.success[disabled]:focus,
fieldset[disabled] .notification_widget.success:focus,
.notification_widget.success.disabled.focus,
.notification_widget.success[disabled].focus,
fieldset[disabled] .notification_widget.success.focus {
  background-color: #5cb85c;
  border-color: #4cae4c;
}
.notification_widget.success .badge {
  color: #5cb85c;
  background-color: #fff;
}
.notification_widget.info {
  color: #fff;
  background-color: #5bc0de;
  border-color: #46b8da;
}
.notification_widget.info:focus,
.notification_widget.info.focus {
  color: #fff;
  background-color: #31b0d5;
  border-color: #1b6d85;
}
.notification_widget.info:hover {
  color: #fff;
  background-color: #31b0d5;
  border-color: #269abc;
}
.notification_widget.info:active,
.notification_widget.info.active,
.open > .dropdown-toggle.notification_widget.info {
  color: #fff;
  background-color: #31b0d5;
  border-color: #269abc;
}
.notification_widget.info:active:hover,
.notification_widget.info.active:hover,
.open > .dropdown-toggle.notification_widget.info:hover,
.notification_widget.info:active:focus,
.notification_widget.info.active:focus,
.open > .dropdown-toggle.notification_widget.info:focus,
.notification_widget.info:active.focus,
.notification_widget.info.active.focus,
.open > .dropdown-toggle.notification_widget.info.focus {
  color: #fff;
  background-color: #269abc;
  border-color: #1b6d85;
}
.notification_widget.info:active,
.notification_widget.info.active,
.open > .dropdown-toggle.notification_widget.info {
  background-image: none;
}
.notification_widget.info.disabled:hover,
.notification_widget.info[disabled]:hover,
fieldset[disabled] .notification_widget.info:hover,
.notification_widget.info.disabled:focus,
.notification_widget.info[disabled]:focus,
fieldset[disabled] .notification_widget.info:focus,
.notification_widget.info.disabled.focus,
.notification_widget.info[disabled].focus,
fieldset[disabled] .notification_widget.info.focus {
  background-color: #5bc0de;
  border-color: #46b8da;
}
.notification_widget.info .badge {
  color: #5bc0de;
  background-color: #fff;
}
.notification_widget.danger {
  color: #fff;
  background-color: #d9534f;
  border-color: #d43f3a;
}
.notification_widget.danger:focus,
.notification_widget.danger.focus {
  color: #fff;
  background-color: #c9302c;
  border-color: #761c19;
}
.notification_widget.danger:hover {
  color: #fff;
  background-color: #c9302c;
  border-color: #ac2925;
}
.notification_widget.danger:active,
.notification_widget.danger.active,
.open > .dropdown-toggle.notification_widget.danger {
  color: #fff;
  background-color: #c9302c;
  border-color: #ac2925;
}
.notification_widget.danger:active:hover,
.notification_widget.danger.active:hover,
.open > .dropdown-toggle.notification_widget.danger:hover,
.notification_widget.danger:active:focus,
.notification_widget.danger.active:focus,
.open > .dropdown-toggle.notification_widget.danger:focus,
.notification_widget.danger:active.focus,
.notification_widget.danger.active.focus,
.open > .dropdown-toggle.notification_widget.danger.focus {
  color: #fff;
  background-color: #ac2925;
  border-color: #761c19;
}
.notification_widget.danger:active,
.notification_widget.danger.active,
.open > .dropdown-toggle.notification_widget.danger {
  background-image: none;
}
.notification_widget.danger.disabled:hover,
.notification_widget.danger[disabled]:hover,
fieldset[disabled] .notification_widget.danger:hover,
.notification_widget.danger.disabled:focus,
.notification_widget.danger[disabled]:focus,
fieldset[disabled] .notification_widget.danger:focus,
.notification_widget.danger.disabled.focus,
.notification_widget.danger[disabled].focus,
fieldset[disabled] .notification_widget.danger.focus {
  background-color: #d9534f;
  border-color: #d43f3a;
}
.notification_widget.danger .badge {
  color: #d9534f;
  background-color: #fff;
}
div#pager {
  background-color: #fff;
  font-size: 14px;
  line-height: 20px;
  overflow: hidden;
  display: none;
  position: fixed;
  bottom: 0px;
  width: 100%;
  max-height: 50%;
  padding-top: 8px;
  -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  /* Display over codemirror */
  z-index: 100;
  /* Hack which prevents jquery ui resizable from changing top. */
  top: auto !important;
}
div#pager pre {
  line-height: 1.21429em;
  color: #000;
  background-color: #f7f7f7;
  padding: 0.4em;
}
div#pager #pager-button-area {
  position: absolute;
  top: 8px;
  right: 20px;
}
div#pager #pager-contents {
  position: relative;
  overflow: auto;
  width: 100%;
  height: 100%;
}
div#pager #pager-contents #pager-container {
  position: relative;
  padding: 15px 0px;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
}
div#pager .ui-resizable-handle {
  top: 0px;
  height: 8px;
  background: #f7f7f7;
  border-top: 1px solid #cfcfcf;
  border-bottom: 1px solid #cfcfcf;
  /* This injects handle bars (a short, wide = symbol) for 
        the resize handle. */
}
div#pager .ui-resizable-handle::after {
  content: '';
  top: 2px;
  left: 50%;
  height: 3px;
  width: 30px;
  margin-left: -15px;
  position: absolute;
  border-top: 1px solid #cfcfcf;
}
.quickhelp {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
  line-height: 1.8em;
}
.shortcut_key {
  display: inline-block;
  width: 21ex;
  text-align: right;
  font-family: monospace;
}
.shortcut_descr {
  display: inline-block;
  /* Old browsers */
  -webkit-box-flex: 1;
  -moz-box-flex: 1;
  box-flex: 1;
  /* Modern browsers */
  flex: 1;
}
span.save_widget {
  height: 30px;
  margin-top: 4px;
  display: flex;
  justify-content: flex-start;
  align-items: baseline;
  width: 50%;
  flex: 1;
}
span.save_widget span.filename {
  height: 100%;
  line-height: 1em;
  margin-left: 16px;
  border: none;
  font-size: 146.5%;
  text-overflow: ellipsis;
  overflow: hidden;
  white-space: nowrap;
  border-radius: 2px;
}
span.save_widget span.filename:hover {
  background-color: #e6e6e6;
}
[dir="rtl"] span.save_widget.pull-left {
  float: right !important;
  float: right;
}
[dir="rtl"] span.save_widget span.filename {
  margin-left: 0;
  margin-right: 16px;
}
span.checkpoint_status,
span.autosave_status {
  font-size: small;
  white-space: nowrap;
  padding: 0 5px;
}
@media (max-width: 767px) {
  span.save_widget {
    font-size: small;
    padding: 0 0 0 5px;
  }
  span.checkpoint_status,
  span.autosave_status {
    display: none;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  span.checkpoint_status {
    display: none;
  }
  span.autosave_status {
    font-size: x-small;
  }
}
.toolbar {
  padding: 0px;
  margin-left: -5px;
  margin-top: 2px;
  margin-bottom: 5px;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
}
.toolbar select,
.toolbar label {
  width: auto;
  vertical-align: middle;
  margin-right: 2px;
  margin-bottom: 0px;
  display: inline;
  font-size: 92%;
  margin-left: 0.3em;
  margin-right: 0.3em;
  padding: 0px;
  padding-top: 3px;
}
.toolbar .btn {
  padding: 2px 8px;
}
.toolbar .btn-group {
  margin-top: 0px;
  margin-left: 5px;
}
.toolbar-btn-label {
  margin-left: 6px;
}
#maintoolbar {
  margin-bottom: -3px;
  margin-top: -8px;
  border: 0px;
  min-height: 27px;
  margin-left: 0px;
  padding-top: 11px;
  padding-bottom: 3px;
}
#maintoolbar .navbar-text {
  float: none;
  vertical-align: middle;
  text-align: right;
  margin-left: 5px;
  margin-right: 0px;
  margin-top: 0px;
}
.select-xs {
  height: 24px;
}
[dir="rtl"] .btn-group > .btn,
.btn-group-vertical > .btn {
  float: right;
}
.pulse,
.dropdown-menu > li > a.pulse,
li.pulse > a.dropdown-toggle,
li.pulse.open > a.dropdown-toggle {
  background-color: #F37626;
  color: white;
}
/**
 * Primary styles
 *
 * Author: Jupyter Development Team
 */
/** WARNING IF YOU ARE EDITTING THIS FILE, if this is a .css file, It has a lot
 * of chance of beeing generated from the ../less/[samename].less file, you can
 * try to get back the less file by reverting somme commit in history
 **/
/*
 * We'll try to get something pretty, so we
 * have some strange css to have the scroll bar on
 * the left with fix button on the top right of the tooltip
 */
@-moz-keyframes fadeOut {
  from {
    opacity: 1;
  }
  to {
    opacity: 0;
  }
}
@-webkit-keyframes fadeOut {
  from {
    opacity: 1;
  }
  to {
    opacity: 0;
  }
}
@-moz-keyframes fadeIn {
  from {
    opacity: 0;
  }
  to {
    opacity: 1;
  }
}
@-webkit-keyframes fadeIn {
  from {
    opacity: 0;
  }
  to {
    opacity: 1;
  }
}
/*properties of tooltip after "expand"*/
.bigtooltip {
  overflow: auto;
  height: 200px;
  -webkit-transition-property: height;
  -webkit-transition-duration: 500ms;
  -moz-transition-property: height;
  -moz-transition-duration: 500ms;
  transition-property: height;
  transition-duration: 500ms;
}
/*properties of tooltip before "expand"*/
.smalltooltip {
  -webkit-transition-property: height;
  -webkit-transition-duration: 500ms;
  -moz-transition-property: height;
  -moz-transition-duration: 500ms;
  transition-property: height;
  transition-duration: 500ms;
  text-overflow: ellipsis;
  overflow: hidden;
  height: 80px;
}
.tooltipbuttons {
  position: absolute;
  padding-right: 15px;
  top: 0px;
  right: 0px;
}
.tooltiptext {
  /*avoid the button to overlap on some docstring*/
  padding-right: 30px;
}
.ipython_tooltip {
  max-width: 700px;
  /*fade-in animation when inserted*/
  -webkit-animation: fadeOut 400ms;
  -moz-animation: fadeOut 400ms;
  animation: fadeOut 400ms;
  -webkit-animation: fadeIn 400ms;
  -moz-animation: fadeIn 400ms;
  animation: fadeIn 400ms;
  vertical-align: middle;
  background-color: #f7f7f7;
  overflow: visible;
  border: #ababab 1px solid;
  outline: none;
  padding: 3px;
  margin: 0px;
  padding-left: 7px;
  font-family: monospace;
  min-height: 50px;
  -moz-box-shadow: 0px 6px 10px -1px #adadad;
  -webkit-box-shadow: 0px 6px 10px -1px #adadad;
  box-shadow: 0px 6px 10px -1px #adadad;
  border-radius: 2px;
  position: absolute;
  z-index: 1000;
}
.ipython_tooltip a {
  float: right;
}
.ipython_tooltip .tooltiptext pre {
  border: 0;
  border-radius: 0;
  font-size: 100%;
  background-color: #f7f7f7;
}
.pretooltiparrow {
  left: 0px;
  margin: 0px;
  top: -16px;
  width: 40px;
  height: 16px;
  overflow: hidden;
  position: absolute;
}
.pretooltiparrow:before {
  background-color: #f7f7f7;
  border: 1px #ababab solid;
  z-index: 11;
  content: "";
  position: absolute;
  left: 15px;
  top: 10px;
  width: 25px;
  height: 25px;
  -webkit-transform: rotate(45deg);
  -moz-transform: rotate(45deg);
  -ms-transform: rotate(45deg);
  -o-transform: rotate(45deg);
}
ul.typeahead-list i {
  margin-left: -10px;
  width: 18px;
}
[dir="rtl"] ul.typeahead-list i {
  margin-left: 0;
  margin-right: -10px;
}
ul.typeahead-list {
  max-height: 80vh;
  overflow: auto;
}
ul.typeahead-list > li > a {
  /** Firefox bug **/
  /* see https://github.com/jupyter/notebook/issues/559 */
  white-space: normal;
}
ul.typeahead-list  > li > a.pull-right {
  float: left !important;
  float: left;
}
[dir="rtl"] .typeahead-list {
  text-align: right;
}
.cmd-palette .modal-body {
  padding: 7px;
}
.cmd-palette form {
  background: white;
}
.cmd-palette input {
  outline: none;
}
.no-shortcut {
  min-width: 20px;
  color: transparent;
}
[dir="rtl"] .no-shortcut.pull-right {
  float: left !important;
  float: left;
}
[dir="rtl"] .command-shortcut.pull-right {
  float: left !important;
  float: left;
}
.command-shortcut:before {
  content: "(command mode)";
  padding-right: 3px;
  color: #777777;
}
.edit-shortcut:before {
  content: "(edit)";
  padding-right: 3px;
  color: #777777;
}
[dir="rtl"] .edit-shortcut.pull-right {
  float: left !important;
  float: left;
}
#find-and-replace #replace-preview .match,
#find-and-replace #replace-preview .insert {
  background-color: #BBDEFB;
  border-color: #90CAF9;
  border-style: solid;
  border-width: 1px;
  border-radius: 0px;
}
[dir="ltr"] #find-and-replace .input-group-btn + .form-control {
  border-left: none;
}
[dir="rtl"] #find-and-replace .input-group-btn + .form-control {
  border-right: none;
}
#find-and-replace #replace-preview .replace .match {
  background-color: #FFCDD2;
  border-color: #EF9A9A;
  border-radius: 0px;
}
#find-and-replace #replace-preview .replace .insert {
  background-color: #C8E6C9;
  border-color: #A5D6A7;
  border-radius: 0px;
}
#find-and-replace #replace-preview {
  max-height: 60vh;
  overflow: auto;
}
#find-and-replace #replace-preview pre {
  padding: 5px 10px;
}
.terminal-app {
  background: #EEE;
}
.terminal-app #header {
  background: #fff;
  -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
}
.terminal-app .terminal {
  width: 100%;
  float: left;
  font-family: monospace;
  color: white;
  background: black;
  padding: 0.4em;
  border-radius: 2px;
  -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.4);
  box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.4);
}
.terminal-app .terminal,
.terminal-app .terminal dummy-screen {
  line-height: 1em;
  font-size: 14px;
}
.terminal-app .terminal .xterm-rows {
  padding: 10px;
}
.terminal-app .terminal-cursor {
  color: black;
  background: white;
}
.terminal-app #terminado-container {
  margin-top: 20px;
}
/*# sourceMappingURL=style.min.css.map */
    </style>
<style type="text/css">
    .highlight .hll { background-color: #ffffcc }
.highlight  { background: #f8f8f8; }
.highlight .c { color: #408080; font-style: italic } /* Comment */
.highlight .err { border: 1px solid #FF0000 } /* Error */
.highlight .k { color: #008000; font-weight: bold } /* Keyword */
.highlight .o { color: #666666 } /* Operator */
.highlight .ch { color: #408080; font-style: italic } /* Comment.Hashbang */
.highlight .cm { color: #408080; font-style: italic } /* Comment.Multiline */
.highlight .cp { color: #BC7A00 } /* Comment.Preproc */
.highlight .cpf { color: #408080; font-style: italic } /* Comment.PreprocFile */
.highlight .c1 { color: #408080; font-style: italic } /* Comment.Single */
.highlight .cs { color: #408080; font-style: italic } /* Comment.Special */
.highlight .gd { color: #A00000 } /* Generic.Deleted */
.highlight .ge { font-style: italic } /* Generic.Emph */
.highlight .gr { color: #FF0000 } /* Generic.Error */
.highlight .gh { color: #000080; font-weight: bold } /* Generic.Heading */
.highlight .gi { color: #00A000 } /* Generic.Inserted */
.highlight .go { color: #888888 } /* Generic.Output */
.highlight .gp { color: #000080; font-weight: bold } /* Generic.Prompt */
.highlight .gs { font-weight: bold } /* Generic.Strong */
.highlight .gu { color: #800080; font-weight: bold } /* Generic.Subheading */
.highlight .gt { color: #0044DD } /* Generic.Traceback */
.highlight .kc { color: #008000; font-weight: bold } /* Keyword.Constant */
.highlight .kd { color: #008000; font-weight: bold } /* Keyword.Declaration */
.highlight .kn { color: #008000; font-weight: bold } /* Keyword.Namespace */
.highlight .kp { color: #008000 } /* Keyword.Pseudo */
.highlight .kr { color: #008000; font-weight: bold } /* Keyword.Reserved */
.highlight .kt { color: #B00040 } /* Keyword.Type */
.highlight .m { color: #666666 } /* Literal.Number */
.highlight .s { color: #BA2121 } /* Literal.String */
.highlight .na { color: #7D9029 } /* Name.Attribute */
.highlight .nb { color: #008000 } /* Name.Builtin */
.highlight .nc { color: #0000FF; font-weight: bold } /* Name.Class */
.highlight .no { color: #880000 } /* Name.Constant */
.highlight .nd { color: #AA22FF } /* Name.Decorator */
.highlight .ni { color: #999999; font-weight: bold } /* Name.Entity */
.highlight .ne { color: #D2413A; font-weight: bold } /* Name.Exception */
.highlight .nf { color: #0000FF } /* Name.Function */
.highlight .nl { color: #A0A000 } /* Name.Label */
.highlight .nn { color: #0000FF; font-weight: bold } /* Name.Namespace */
.highlight .nt { color: #008000; font-weight: bold } /* Name.Tag */
.highlight .nv { color: #19177C } /* Name.Variable */
.highlight .ow { color: #AA22FF; font-weight: bold } /* Operator.Word */
.highlight .w { color: #bbbbbb } /* Text.Whitespace */
.highlight .mb { color: #666666 } /* Literal.Number.Bin */
.highlight .mf { color: #666666 } /* Literal.Number.Float */
.highlight .mh { color: #666666 } /* Literal.Number.Hex */
.highlight .mi { color: #666666 } /* Literal.Number.Integer */
.highlight .mo { color: #666666 } /* Literal.Number.Oct */
.highlight .sa { color: #BA2121 } /* Literal.String.Affix */
.highlight .sb { color: #BA2121 } /* Literal.String.Backtick */
.highlight .sc { color: #BA2121 } /* Literal.String.Char */
.highlight .dl { color: #BA2121 } /* Literal.String.Delimiter */
.highlight .sd { color: #BA2121; font-style: italic } /* Literal.String.Doc */
.highlight .s2 { color: #BA2121 } /* Literal.String.Double */
.highlight .se { color: #BB6622; font-weight: bold } /* Literal.String.Escape */
.highlight .sh { color: #BA2121 } /* Literal.String.Heredoc */
.highlight .si { color: #BB6688; font-weight: bold } /* Literal.String.Interpol */
.highlight .sx { color: #008000 } /* Literal.String.Other */
.highlight .sr { color: #BB6688 } /* Literal.String.Regex */
.highlight .s1 { color: #BA2121 } /* Literal.String.Single */
.highlight .ss { color: #19177C } /* Literal.String.Symbol */
.highlight .bp { color: #008000 } /* Name.Builtin.Pseudo */
.highlight .fm { color: #0000FF } /* Name.Function.Magic */
.highlight .vc { color: #19177C } /* Name.Variable.Class */
.highlight .vg { color: #19177C } /* Name.Variable.Global */
.highlight .vi { color: #19177C } /* Name.Variable.Instance */
.highlight .vm { color: #19177C } /* Name.Variable.Magic */
.highlight .il { color: #666666 } /* Literal.Number.Integer.Long */
    </style>
<style type="text/css">
    
/* Temporary definitions which will become obsolete with Notebook release 5.0 */
.ansi-black-fg { color: #3E424D; }
.ansi-black-bg { background-color: #3E424D; }
.ansi-black-intense-fg { color: #282C36; }
.ansi-black-intense-bg { background-color: #282C36; }
.ansi-red-fg { color: #E75C58; }
.ansi-red-bg { background-color: #E75C58; }
.ansi-red-intense-fg { color: #B22B31; }
.ansi-red-intense-bg { background-color: #B22B31; }
.ansi-green-fg { color: #00A250; }
.ansi-green-bg { background-color: #00A250; }
.ansi-green-intense-fg { color: #007427; }
.ansi-green-intense-bg { background-color: #007427; }
.ansi-yellow-fg { color: #DDB62B; }
.ansi-yellow-bg { background-color: #DDB62B; }
.ansi-yellow-intense-fg { color: #B27D12; }
.ansi-yellow-intense-bg { background-color: #B27D12; }
.ansi-blue-fg { color: #208FFB; }
.ansi-blue-bg { background-color: #208FFB; }
.ansi-blue-intense-fg { color: #0065CA; }
.ansi-blue-intense-bg { background-color: #0065CA; }
.ansi-magenta-fg { color: #D160C4; }
.ansi-magenta-bg { background-color: #D160C4; }
.ansi-magenta-intense-fg { color: #A03196; }
.ansi-magenta-intense-bg { background-color: #A03196; }
.ansi-cyan-fg { color: #60C6C8; }
.ansi-cyan-bg { background-color: #60C6C8; }
.ansi-cyan-intense-fg { color: #258F8F; }
.ansi-cyan-intense-bg { background-color: #258F8F; }
.ansi-white-fg { color: #C5C1B4; }
.ansi-white-bg { background-color: #C5C1B4; }
.ansi-white-intense-fg { color: #A1A6B2; }
.ansi-white-intense-bg { background-color: #A1A6B2; }

.ansi-bold { font-weight: bold; }

    </style>


<style type="text/css">
/* Overrides of notebook CSS for static HTML export */
body {
  overflow: visible;
  padding: 8px;
}

div#notebook {
  overflow: visible;
  border-top: none;
}@media print {
  div.cell {
    display: block;
    page-break-inside: avoid;
  } 
  div.output_wrapper { 
    display: block;
    page-break-inside: avoid; 
  }
  div.output { 
    display: block;
    page-break-inside: avoid; 
  }
}
</style>

<!-- Custom stylesheet, it must be in the same directory as the html file -->
<link rel="stylesheet" href="custom.css">

<!-- Loading mathjax macro -->
<!-- Load mathjax -->
    <script src="https://cdnjs.cloudflare.com/ajax/libs/mathjax/2.7.1/MathJax.js?config=TeX-AMS_HTML"></script>
    <!-- MathJax configuration -->
    <script type="text/x-mathjax-config">
    MathJax.Hub.Config({
        tex2jax: {
            inlineMath: [ ['$','$'], ["\\(","\\)"] ],
            displayMath: [ ['$$','$$'], ["\\[","\\]"] ],
            processEscapes: true,
            processEnvironments: true
        },
        // Center justify equations in code and markdown cells. Elsewhere
        // we use CSS to left justify single line equations in code cells.
        displayAlign: 'center',
        "HTML-CSS": {
            styles: {'.MathJax_Display': {"margin": 0}},
            linebreaks: { automatic: true }
        }
    });
    </script>
    <!-- End of mathjax configuration --></head>

 <link rel="stylesheet" href="https://cdnjs.cloudflare.com/ajax/libs/jqueryui/1.12.1/jquery-ui.css">

<script type="text/javascript" src="https://cdnjs.cloudflare.com/ajax/libs/jqueryui/1.9.1/jquery-ui.min.js"></script>

<link rel="stylesheet" type="text/css" href="https://rawgit.com/ipython-contrib/jupyter_contrib_nbextensions/master/src/jupyter_contrib_nbextensions/nbextensions/toc2/main.css">

<link rel="stylesheet" type="text/css" href="https://cdnjs.cloudflare.com/ajax/libs/font-awesome/4.7.0/css/font-awesome.min.css">

<script src="https://rawgit.com/ipython-contrib/jupyter_contrib_nbextensions/master/src/jupyter_contrib_nbextensions/nbextensions/toc2/toc2.js"></script>

<script>
$( document ).ready(function(){

            var cfg = {"base_numbering": "0", "nav_menu": {}, "number_sections": true, "sideBar": true, "skip_h1_title": true, "title_cell": "Table of Contents", "title_sidebar": "Contents", "toc_cell": false, "toc_position": {"height": "487px", "left": "1241px", "top": "350px", "width": "328.796875px"}, "toc_section_display": true, "toc_window_display": true};

            // fire the main function with these parameters
            require(['nbextensions/toc2/toc2'], function (toc2) {
                toc2.table_of_contents(cfg);
            });
    });
</script>
<body>
  <div tabindex="-1" id="notebook" class="border-box-sizing">
    <div class="container" id="notebook-container">

<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h1 id="Transcriptome-Assembly-Pipeline-|-Last-edited:-27Nov2018">Transcriptome Assembly Pipeline <font size="4">| Last edited: 27Nov2018</font><a class="anchor-link" href="#Transcriptome-Assembly-Pipeline-|-Last-edited:-27Nov2018">&#182;</a></h1><h3 id="Tauana-Junqueira-Cunha-|-tauanacunha[at]g.harvard.edu-"><a href="https://github.com/tauanajc" title="GITHUB">Tauana Junqueira Cunha</a> | tauanacunha[at]g.harvard.edu <a class="tocSkip" /><a class="anchor-link" href="#Tauana-Junqueira-Cunha-|-tauanacunha[at]g.harvard.edu-">&#182;</a></h3><p>This notebook contains a detailed pipeline used to assemble gastropod transcriptomes from raw Illumina paired-end reads. It was written initially for my own use and therefore contains personal notes. Folder/file structure is specific to my projects; scripts were written for a SLURM cluster controller. Everything can be adjusted to other users and purposes with only a few small changes. For each software, I chose the options that I thought were most appropriate for my data - make sure you understand what the commands are doing if reusing these scripts with different data.</p>
<blockquote><ul>
<li>Source code for scripts mentioned here are in <a href="https://github.com/tauanajc/Cunha_Giribet_2019_ProcRSocB">https://github.com/tauanajc/Cunha_Giribet_2019_ProcRSocB</a></li>
<li>If you use this pipeline or any of the associated scripts, please cite the original publication:</li>
</ul>
<h3 id="Cunha-TJ,-Giribet-G.-2019-A-congruent-topology-for-deep-gastropod-relationships.-Proc.-R.-Soc.-B-286:-20182776.-doi:-10.1098/rspb.2018.2776.">Cunha TJ, Giribet G. 2019 <a href="http://dx.doi.org/10.1098/rspb.2018.2776">A congruent topology for deep gastropod relationships</a>. Proc. R. Soc. B 286: 20182776. doi: 10.1098/rspb.2018.2776.<a class="tocSkip" /><a class="anchor-link" href="#Cunha-TJ,-Giribet-G.-2019-A-congruent-topology-for-deep-gastropod-relationships.-Proc.-R.-Soc.-B-286:-20182776.-doi:-10.1098/rspb.2018.2776.">&#182;</a></h3>
</blockquote>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h2 id="General-information">General information<a class="anchor-link" href="#General-information">&#182;</a></h2>
</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h3 id="Keep-track-of-your-analyses">Keep track of your analyses<a class="anchor-link" href="#Keep-track-of-your-analyses">&#182;</a></h3><p>Table with (Time to run / Memory MaxRSS) for all main jobs.</p>
<p>Organization of folders/files in a project:</p>
<ul>
<li><strong>rawdata</strong> (as from sequencing facility)</li>
<li><strong>raw_reads</strong> (permanent storage of concatenated reads Forward and Reverse for all of species)</li>
<li><strong>sra</strong> (permanent storage of reads Forward and Reverse for all species downloaded from SRA)</li>
<li><strong>raw_assemblies</strong> (permanent storage of Trinity.fasta files for all species)</li>
<li><strong>ready_oma</strong> (permanent storage of final assemblies in peptides for all species)</li>
<li><strong>done_assemblies / prep_for_assemblies</strong> (with folder per species in which go folders/files of TrimGalore, Bowtie, Trinity, Transdecoder) (Only kept intermediary files of new data, not SRA)</li>
<li><strong>fastqc_reports</strong> (with all fastqc files, from trimmed reads and from Bowtie cleaned reads for all species)</li>
<li><strong>bowtie_base</strong> (with database to be excluded - rRNA, mitochondrial)</li>
<li><strong>scripts</strong></li>
</ul>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h3 id="Slurm-array-jobs">Slurm array jobs<a class="anchor-link" href="#Slurm-array-jobs">&#182;</a></h3><p>Whenever a job is called as an array, the numbers will refer to items/lines in a list/file (<strong>folder-names.txt</strong> in prep_for_assemblies folder). The array number is appended to the out/err file name with %a. The number is also saved in the variable $SLURM_ARRAY_TASK_ID while the job is running. I use the species name as the folder name, therefore spp_dir is equivalent to the species name.</p>
<ul>
<li>Example:</li>
</ul>
<div class="highlight"><pre><span></span>sbatch --array<span class="o">=</span><span class="m">5</span>-9 script.sh <span class="c1"># Calls script.sh for five independent jobs, identified by array numbers 5-9</span>
</pre></div>
<ul>
<li><p>If starting a project, create a simple text file listing species/folder names, one per line. Can keep adding new taxa at the end.</p>
</li>
<li><p>Take note of which lines/numbers will be run so don't redo species that were already ran.</p>
</li>
</ul>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h3 id="Storing-raw-data">Storing raw data<a class="anchor-link" href="#Storing-raw-data">&#182;</a></h3><p>Download raw data from cluster to rawdata folder. Keep backup at the lab rawdata folder.<br></p>
<ul>
<li>Do md5sum to guarantee transfer was ok: Use awk to invert position of the two columns in the md5sum.txt file. Then run md5sum command to actually check the bits.</li>
</ul>
<div class="highlight"><pre><span></span><span class="nb">cd</span> ClusterFolderFromSequencingFacility
rsync -az ./ /n/Giribet_Lab/tauanajc/GASTROPODA/rawdata/FLOWCELLFOLDER/ <span class="p">&amp;</span>

awk -F <span class="s1">$&#39;\t&#39;</span> <span class="s1">&#39; {t=$1;$1=$2;$2=t;print;} &#39;</span> <span class="nv">OFS</span><span class="o">=</span><span class="s1">$&#39;  &#39;</span> md5sum.txt &gt; md5sum-2.txt
md5sum -c md5sum-2.txt
</pre></div>
<p>Info on awk command for this specific case: <a href="http://stackoverflow.com/questions/11967776/swap-two-columns-awk-sed-python-perl">http://stackoverflow.com/questions/11967776/swap-two-columns-awk-sed-python-perl</a></p>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h3 id="Merge-reads-Forward-/-Reverse,-count">Merge reads Forward / Reverse, count<a class="anchor-link" href="#Merge-reads-Forward-/-Reverse,-count">&#182;</a></h3><p>(From the two different Lanes)</p>
<ul>
<li>Use full path from <strong>rawdata</strong> folder to get the input files, and save merged file in <strong>raw_reads</strong> folder</li>
<li>Give the species name to the merged file</li>
<li><strong>Merge fastq(.gz) files</strong> by simply concatenating them with cat</li>
<li>Can concatenate unzipped or zipped files, it doesn't matter</li>
</ul>
<div class="highlight"><pre><span></span>cat Lane1-R1.fastq.gz Lane2-R1.fastq.gz &gt; Species_R1.fastq.gz
cat Lane1-R2.fastq.gz Lane2-R2.fastq.gz &gt; Species_R2.fastq.gz
</pre></div>
<ul>
<li>From within <strong>Lane1/Fastq folder, run:</strong></li>
</ul>
<div class="highlight"><pre><span></span><span class="k">for</span> i in Amblychilepas_nigrita Cellana_radiata OTHER_SPP_FLOWCELL<span class="p">;</span> <span class="k">do</span>
cat <span class="si">${</span><span class="nv">i</span><span class="si">}</span>*R1* ../../Lane2.indexlength_6/Fastq/<span class="si">${</span><span class="nv">i</span><span class="si">}</span>*R1* &gt; /n/Giribet_Lab/tauanajc/GASTROPODA/raw_reads/<span class="si">${</span><span class="nv">i</span><span class="si">}</span>_R1.fastq.gz
cat <span class="si">${</span><span class="nv">i</span><span class="si">}</span>*R2* ../../Lane2.indexlength_6/Fastq/<span class="si">${</span><span class="nv">i</span><span class="si">}</span>*R2* &gt; /n/Giribet_Lab/tauanajc/GASTROPODA/raw_reads/<span class="si">${</span><span class="nv">i</span><span class="si">}</span>_R2.fastq.gz
<span class="k">done</span>
</pre></div>
<ul>
<li>Then <strong>count number of read pairs</strong> by counting the reads in one of the merged files (R1 and R2 have the same number)</li>
</ul>
<div class="highlight"><pre><span></span><span class="k">for</span> i in Amblychilepas_nigrita Cellana_radiata OTHER_SPP_FLOWCELL<span class="p">;</span> <span class="k">do</span> <span class="c1"># In raw_reads folder</span>
<span class="nb">echo</span> <span class="si">${</span><span class="nv">i</span><span class="si">}</span> R1:
gunzip -c <span class="si">${</span><span class="nv">i</span><span class="si">}</span>_R1.fastq.gz <span class="p">|</span> grep -c @HISEQ <span class="c1"># -c just unzips to memory/stdout, doesn&#39;t change original file</span>
<span class="k">done</span>
</pre></div>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h3 id="Downloading-published-data-from-SRA">Downloading published data from SRA<a class="anchor-link" href="#Downloading-published-data-from-SRA">&#182;</a></h3><p><a href="https://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=toolkit_doc&amp;f=fastq-dump">https://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=toolkit_doc&amp;f=fastq-dump</a></p>
<p>Find the samples in NCBI SRA base. SRX is identifier of experiment, but SRR is actual run and data.<br>
Would not be necessary if only using your own data. If need to download, do this in the beginning of the project, so can run the rest of the pipeline in parallel for all data.</p>
<ul>
<li>Can download with sratoolkit module in the cluster, however <em>prefetch</em> doesn't work very well. Instead I use <em>wget</em>, then sratoolkit to <em>fastqdump</em>.</li>
</ul>
<ul>
<li><strong>Needs a file srainfo.txt with two columns separated by comma, no headers: 1) species names, 2) SRRid</strong></li>
</ul>
<ul>
<li>Run from <strong>prep_for_assemblies</strong>:
<br><div class="highlight"><pre><span></span>sbatch --array<span class="o">=</span><span class="m">1</span>-4 ../scripts/wgetsra.sh
</pre></div>
</li>
</ul>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span>%%bash
<span class="c1">#!/bin/bash</span>

<span class="c1">#SBATCH -J SRA_WGet                             # Job name </span>
<span class="c1">#SBATCH -o SRAwget.%a.%A.out                    # File to which stdout will be written</span>
<span class="c1">#SBATCH -e SRAwget.%a.%A.err                    # File to which stderr will be written</span>
<span class="c1">#SBATCH --mail-type=ALL                         # BEGIN,END,ALL</span>
<span class="c1">#SBATCH --mail-user=tauanacunha@g.harvard.edu   # Email address</span>
<span class="c1">#SBATCH -N 1                                    # Ensure that all cores are on one machine</span>
<span class="c1">#SBATCH -n 1                                    # Number of cores/cpus</span>
<span class="c1">#SBATCH -t 00-05:00                             # Runtime in DD-HH:MM</span>
<span class="c1">#SBATCH --mem 3000                              # Memory for all cores in Mbytes (--mem-per-cpu for MPI jobs)</span>
<span class="c1">#SBATCH -p shared                               # Partition shared, serial_requeue, unrestricted, test</span>

module load sratoolkit/2.8.0-fasrc01

<span class="c1"># Get file info</span>
<span class="nv">NAME</span><span class="o">=</span><span class="k">$(</span>sed -n <span class="s2">&quot;</span><span class="si">${</span><span class="nv">SLURM_ARRAY_TASK_ID</span><span class="si">}</span><span class="s2">p&quot;</span> srainfo.txt <span class="p">|</span> cut -d , -f <span class="m">1</span><span class="k">)</span>
<span class="nv">NAME</span><span class="o">=</span><span class="si">${</span><span class="nv">NAME</span><span class="p">// /_</span><span class="si">}</span> <span class="c1"># Replace spaces by underlines in name</span>
<span class="nv">SRA</span><span class="o">=</span><span class="k">$(</span>sed -n <span class="s2">&quot;</span><span class="si">${</span><span class="nv">SLURM_ARRAY_TASK_ID</span><span class="si">}</span><span class="s2">p&quot;</span> srainfo.txt <span class="p">|</span> cut -d , -f <span class="m">2</span><span class="k">)</span>
<span class="nv">SITE</span><span class="o">=</span>ftp://ftp-trace.ncbi.nih.gov/sra/sra-instant/reads/ByRun/sra <span class="c1"># NCBI instructions</span>
<span class="c1"># http://sra-download.ncbi.nlm.nih.gov/srapub/$SRA # Got this from .err file of srafetch</span>

<span class="nv">srafolder</span><span class="o">=</span>/n/Giribet_Lab/tauanajc/GASTROPODA/sra
mkdir -p <span class="nv">$NAME</span>


<span class="c1"># Fetch SRA</span>
<span class="nb">echo</span> Processing <span class="nv">$NAME</span> <span class="nv">$SRA</span>
wget -P <span class="nv">$srafolder</span> <span class="nv">$SITE</span>/<span class="si">${</span><span class="nv">SRA</span><span class="p">:</span><span class="nv">0</span><span class="p">:</span><span class="nv">3</span><span class="si">}</span>/<span class="si">${</span><span class="nv">SRA</span><span class="p">:</span><span class="nv">0</span><span class="p">:</span><span class="nv">6</span><span class="si">}</span>/<span class="nv">$SRA</span>/<span class="nv">$SRA</span>.sra


<span class="c1"># Dump</span>
<span class="nb">cd</span> <span class="nv">$srafolder</span>
fastq-dump -I --defline-seq <span class="s1">&#39;@$sn[_$rn]/$ri&#39;</span> --split-files <span class="nv">$SRA</span>.sra
mv <span class="nv">$SRA</span><span class="se">\_</span><span class="m">1</span>.fastq <span class="nv">$NAME</span><span class="se">\_</span>R1.fastq
mv <span class="nv">$SRA</span><span class="se">\_</span><span class="m">2</span>.fastq <span class="nv">$NAME</span><span class="se">\_</span>R2.fastq
rm <span class="nv">$SRA</span>.sra
gzip <span class="nv">$NAME</span><span class="se">\_</span>R*.fastq
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>wget<br>
Downloads data</p>
<p>fastq-dump<br>
Transforms binary data in fastq format and split reads into R1 and R2 files</p>
<p>-I<br>
Append read id after spot id as 'accession.spot.readid'</p>
<p>--split-files<br>
Dump each read into separate file. Files will receive suffix corresponding to read number.</p>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h2 id="RCorrector:-correct-sequencing-errors">RCorrector: correct sequencing errors<a class="anchor-link" href="#RCorrector:-correct-sequencing-errors">&#182;</a></h2><p>k-mer based method to correct random sequencing errors in Illumina RNA-seq reads. Resources:</p>
<p><a href="https://github.com/mourisl/Rcorrector">https://github.com/mourisl/Rcorrector</a><br>
Harvard FAS script to remove marked reads: <a href="http://informatics.fas.harvard.edu/best-practices-for-de-novo-transcriptome-assembly-with-trinity.html">http://informatics.fas.harvard.edu/best-practices-for-de-novo-transcriptome-assembly-with-trinity.html</a><br></p>
<ul>
<li><a href="https://github.com/tauanajc/Cunha_Giribet_2019_ProcRSocB"><strong>fixrcorrector.py</strong></a> is a custom python script from Adam Freedman (Harvard FAS). I edited it to remove not only the unfixable reads marked by RCorrector, but also the extra information added by RCorrector to the headers (e.g., "cor" and kmer count).</li>
</ul>
<ul>
<li>Call from <strong>prep_for_assemblies</strong> folder as</li>
</ul>
<div class="highlight"><pre><span></span>sbatch --array<span class="o">=</span><span class="m">1</span>-6 ../scripts/rcorrect.sh
</pre></div>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span>%%bash
<span class="c1">#!/bin/bash</span>

<span class="c1">#SBATCH -J RCorrect                             # Job name </span>
<span class="c1">#SBATCH -o RCorrect.%a.%A.out                   # File to which stdout will be written</span>
<span class="c1">#SBATCH -e RCorrect.%a.%A.err                   # File to which stderr will be written</span>
<span class="c1">#SBATCH --mail-type=ALL                         # BEGIN,END,ALL</span>
<span class="c1">#SBATCH --mail-user=tauanacunha@g.harvard.edu   # Email address</span>
<span class="c1">#SBATCH -N 1                                    # Ensure that all cores are on one machine</span>
<span class="c1">#SBATCH -n 12                                   # Number of cores/cpus</span>
<span class="c1">#SBATCH -t 03-00:00                             # Runtime in DD-HH:MM</span>
<span class="c1">#SBATCH --mem 24000                             # Memory for all cores in Mbytes (--mem-per-cpu for MPI jobs)</span>
<span class="c1">#SBATCH -p shared                               # Partition shared, serial_requeue, unrestricted, test</span>


module load perl/5.26.1-fasrc01
module load zlib/1.2.8-fasrc09

<span class="c1"># Create variable to hold the directory name (which is the species name) and move inside folder</span>
<span class="nv">spp_dir</span><span class="o">=</span><span class="k">$(</span>sed -n <span class="s2">&quot;</span><span class="si">${</span><span class="nv">SLURM_ARRAY_TASK_ID</span><span class="si">}</span><span class="s2">p&quot;</span> folder-names.txt<span class="k">)</span>
mkdir -p <span class="nv">$spp_dir</span>/trimG                         <span class="c1"># Create directory for output if it is not already there</span>
<span class="nb">cd</span> <span class="nv">$spp_dir</span>/trimG
<span class="nb">echo</span> ENTERING <span class="nv">$spp_dir</span>/trimG                    <span class="c1"># Print that is entering species folder/trimG just as check point</span>


../../../scripts/RCorrector/run_rcorrector.pl -t <span class="m">12</span> -verbose <span class="se">\</span>
-1 /n/Giribet_Lab/tauanajc/GASTROPODA/raw_reads/<span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>_R1.fastq.gz <span class="se">\</span>
-2 /n/Giribet_Lab/tauanajc/GASTROPODA/raw_reads/<span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>_R2.fastq.gz &gt; /dev/null

python ../../../scripts/fixrcorrector.py -o rcorrected -1 *R1.cor.fq.gz -2 *R2.cor.fq.gz

mv rcorrected_*R1* <span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>_R1.fixed.fq <span class="c1"># Just changing names of rcorrected files</span>
mv rcorrected_*R2* <span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>_R2.fixed.fq
gzip *.fixed.fq

<span class="c1"># Move .err and .out files to trimG folder with rest of output</span>
mv ../../RCorrect.<span class="nv">$SLURM_ARRAY_TASK_ID</span>.* ./
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span>%%bash
<span class="c1"># For SRA data, only change command to:</span>

../../../scripts/RCorrector/run_rcorrector.pl -t <span class="m">12</span> -verbose <span class="se">\</span>
-1 /n/Giribet_Lab/tauanajc/GASTROPODA/sra/<span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>_R1.fastq.gz <span class="se">\</span>
-2 /n/Giribet_Lab/tauanajc/GASTROPODA/sra/<span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>_R2.fastq.gz &gt; /dev/null
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>-s<br>seq_files: comma separated files for single-end data sets</p>
<p>-1<br>seq_files_left: comma separated files for the first mate in the paried-end data sets</p>
<p>-2<br>seq_files_right: comma separated files for the second mate in the paired-end data sets</p>
<p>-od<br>STRING: output_file_directory (default: ./)</p>
<p>-t<br>INT: number of threads to use (default: 1)</p>
<p>-stdout<br>output the corrected reads to stdout (default: not used)</p>
<p>-verbose<br>output some correction information to stdout (default: not used)</p>
<p>-k<br>INT: kmer_length (&lt;=32, default: 23)</p>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<ol>
<li><strong>Go to rmunfixable.log file to get the number of removed/remaining reads</strong></li>
</ol>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h2 id="TrimGalore:-trim-adapters-and-low-quality-reads">TrimGalore: trim adapters and low quality reads<a class="anchor-link" href="#TrimGalore:-trim-adapters-and-low-quality-reads">&#182;</a></h2><p><a href="http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/">http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/</a><br>
<a href="https://github.com/FelixKrueger/TrimGalore/blob/master/Docs/Trim_Galore_User_Guide.md">https://github.com/FelixKrueger/TrimGalore/blob/master/Docs/Trim_Galore_User_Guide.md</a></p>
<ul>
<li>If need to specify full index, choose from list below, reverse complements ready to use</li>
<li>Call from <strong>prep_for_assemblies</strong> folder as</li>
</ul>
<div class="highlight"><pre><span></span>sbatch --array<span class="o">=</span><span class="m">1</span>-6 ../scripts/trimgaloreWafergen.sh
</pre></div>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span>%%bash
<span class="c1">#!/bin/bash</span>

<span class="c1">#SBATCH -J TrimG                                # Job name </span>
<span class="c1">#SBATCH -o TrimG.%a.%A.out                      # File to which stdout will be written</span>
<span class="c1">#SBATCH -e TrimG.%a.%A.err                      # File to which stderr will be written</span>
<span class="c1">#SBATCH --mail-type=ALL                         # BEGIN,END,ALL</span>
<span class="c1">#SBATCH --mail-user=tauanacunha@g.harvard.edu   # Email address</span>
<span class="c1">#SBATCH -N 1                                    # Ensure that all cores are on one machine</span>
<span class="c1">#SBATCH -n 4                                    # Number of cores/cpus</span>
<span class="c1">#SBATCH -t 01-00:00                             # Runtime in DD-HH:MM</span>
<span class="c1">#SBATCH --mem 200                               # Memory for all cores in Mbytes (--mem-per-cpu for MPI jobs)</span>
<span class="c1">#SBATCH -p shared                               # Partition shared, serial_requeue, unrestricted, test</span>

module load cutadapt/1.8.1-fasrc01


<span class="c1"># Create variable to hold the directory name (which is the species name) and move inside folder</span>
<span class="nv">spp_dir</span><span class="o">=</span><span class="k">$(</span>sed -n <span class="s2">&quot;</span><span class="si">${</span><span class="nv">SLURM_ARRAY_TASK_ID</span><span class="si">}</span><span class="s2">p&quot;</span> folder-names.txt<span class="k">)</span>
mkdir -p <span class="nv">$spp_dir</span>/trimG                         <span class="c1"># Create directory for output if it is not already there</span>
<span class="nb">cd</span> <span class="nv">$spp_dir</span>/trimG
<span class="nb">echo</span> ENTERING <span class="nv">$spp_dir</span>/trimG                    <span class="c1"># Print that is entering species folder/trimG just as check point</span>


../../../scripts/Trim_Galore/trim_galore --phred33 --gzip --length <span class="m">50</span> --retain_unpaired --paired <span class="se">\</span>
-a AAGATCGGAAGAGC -a2 GATCGTCGGACTGTAGAA <span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>_R1.fixed.fq.gz <span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>_R2.fixed.fq.gz
<span class="c1"># short sequences of Wafergen library adaptors</span>


<span class="c1"># Move .err and .out files to trimG folder with rest of output</span>
mv ../../TrimG.<span class="nv">$SLURM_ARRAY_TASK_ID</span>.* ./
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span>%%bash
<span class="c1"># For default adapters (universal Illumina), only change command to:</span>

../../../scripts/Trim_Galore/trim_galore --phred33 --gzip --length <span class="m">50</span> --retain_unpaired --paired <span class="se">\</span>
<span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>_R1.fixed.fq.gz <span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>_R2.fixed.fq.gz
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>-a/--adapter [STRING]<br>
Indexed adapter sequence to be trimmed. Can use full length choosing from list below depending on Index used, or just used common beginning like in script (Wafergene adapters)</p>
<p>-a2/--adapter2 [STRING]<br>
Optional adapter sequence to be trimmed off read 2 of paired-end files. This option requires '--paired' to be specified as well. The dafault is the same as -a for universal Illumina adapters, but <strong>Wafergen's R2 is different, so use full or short version of our SRprimer/adapter (below).</strong> (Email correspondence with Felix Krueger from TrimGalore on November 2016)</p>
<p>-q/--quality [INT]<br>
Trim low-quality ends from reads in addition to adapter removal. Files are quality and adapter trimmed in a single pass. The algorithm is the same as the one used by BWA (Subtract INT from all qualities; compute partial sums from all indices to the end of the sequence; cut sequence at the index at which the sum is minimal). Default Phred score: 20. (Lab uses 30)</p>
<p>--phred33<br>
Instructs Cutadapt to use ASCII+33 quality scores as Phred scores (Sanger/Illumina 1.9+ encoding) for quality trimming. Default: ON. Older Illumina would be --phred64</p>
<p>--gzip<br>
Compress the output file with gzip. If the input files are gzip-compressed the output files will be automatically gzip compressed as well</p>
<p>--length [INT]<br>
Discard reads that became shorter than [INT] because of quality or adapter trimming. Default: 20 bp. For paired-end files, both reads of a read-pair need to be longer than [INT] bp to be printed out to validated paired-end files</p>
<p>--paired<br>
Performs length trimming of quality/adapter trimmed reads for paired-end files. To pass the validation test, both sequences of a sequence pair are required to have a certain minimum length. If only one read passes this length threshold the other read can be rescued (--retain_unpaired). Using this option lets you discard too short read pairs without disturbing the sequence-by-sequence order of FastQ files which is required by many aligners</p>
<p>--retain_unpaired<br>
If only one of the two paired-end reads became too short, the longer read will be written to either '.unpaired_1.fq' or '.unpaired_2.fq' output files. Default: OFF</p>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Index Primer 1
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG</p>
<p>Index Primer 2
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG</p>
<p>Index Primer 3
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG</p>
<p>Index Primer 4
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG</p>
<p>Index Primer 5
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG</p>
<p>Index Primer 6
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG</p>
<p>Index Primer 7
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG</p>
<p>Index Primer 8
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG</p>
<p>Index Primer 9
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG</p>
<p>Index Primer 10
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG</p>
<p>Index Primer 11
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG</p>
<p>Index Primer 12
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG</p>
<p>Wafergen's Adapter (-a2)
GATCGTCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTATCATT</p>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<ol>
<li><strong>Go to .err file from trimgalore and copy the number of reads removed to table, to get number of reads remaining. Also check if % of adapters in both sides are approximately the same. If not, it is probably using wrong adapters.</strong></li>
</ol>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h2 id="FastQC:-quality-control-of-trimmed-data">FastQC: quality control of trimmed data<a class="anchor-link" href="#FastQC:-quality-control-of-trimmed-data">&#182;</a></h2><p><a href="http://www.bioinformatics.babraham.ac.uk/projects/fastqc/">http://www.bioinformatics.babraham.ac.uk/projects/fastqc/</a></p>
<ul>
<li>Output folder: fastqc_reports</li>
<li>Run fastqc from <strong>prep_for_assemblies</strong> as</li>
</ul>
<div class="highlight"><pre><span></span>sbatch --array<span class="o">=</span><span class="m">4</span>-6 ../scripts/fastqcTrim.sh
</pre></div>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span>%%bash
<span class="c1">#!/bin/bash</span>

<span class="c1">#SBATCH -J FastQC                               # Job name </span>
<span class="c1">#SBATCH -o FastQC.%a.%A.out                     # File to which stdout will be written</span>
<span class="c1">#SBATCH -e FastQC.%a.%A.err                     # File to which stderr will be written</span>
<span class="c1">#SBATCH --mail-type=ALL                         # BEGIN,END,ALL</span>
<span class="c1">#SBATCH --mail-user=tauanacunha@g.harvard.edu   # Email address</span>
<span class="c1">#SBATCH -N 1                                    # Ensure that all cores are on one machine</span>
<span class="c1">#SBATCH -n 2                                    # Number of cores/cpus</span>
<span class="c1">#SBATCH -t 00-04:00                             # Runtime in DD-HH:MM</span>
<span class="c1">#SBATCH --mem 1000                              # Memory for all cores in Mbytes (--mem-per-cpu for MPI jobs)</span>
<span class="c1">#SBATCH -p serial_requeue                       # Partition shared, serial_requeue, unrestricted, test</span>


module load fastqc/0.11.5-fasrc01


<span class="c1"># Create variable to hold the directory name (which is the species name) and move inside folder</span>
<span class="nv">spp_dir</span><span class="o">=</span><span class="k">$(</span>sed -n <span class="s2">&quot;</span><span class="si">${</span><span class="nv">SLURM_ARRAY_TASK_ID</span><span class="si">}</span><span class="s2">p&quot;</span> folder-names.txt<span class="k">)</span>
<span class="nb">cd</span> <span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>/trimG
<span class="nb">echo</span> ENTERING <span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>/trimG                  <span class="c1"># Print that is entering species folder just as check point</span>


fastqc -o ../../../fastqc_reports -t <span class="m">2</span> --noextract --nogroup *val_*.fq.gz


<span class="c1"># Move .err and .out files to species folder</span>
mv ../../FastQC.<span class="nv">$SLURM_ARRAY_TASK_ID</span>.* ./
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>-o/--outdir<br>
Create all output files in the specified output directory</p>
<p>--noextract<br>
Do not uncompress the output file after creating it.  You should set this option if you do not wish to uncompress the output when running in non-interactive mode</p>
<p>--nogroup<br>
Disable grouping of bases for reads &gt;50bp. All reports will show data for every base in the read.  WARNING: Using this option will cause fastqc to crash and burn if you use it on really long reads, and your plots may end up a ridiculous size. You have been warned!</p>
<p>-t/--threads<br>
Specifies the number of files which can be processed simultaneously.  Each thread will be allocated 250MB of memory so you shouldn't run more threads than your available memory will cope with, and not more than 6 threads on a 32 bit machine</p>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h2 id="Bowtie:-filter-rRNA,-mtDNA-(or-anything)">Bowtie: filter rRNA, mtDNA (or anything)<a class="anchor-link" href="#Bowtie:-filter-rRNA,-mtDNA-(or-anything)">&#182;</a></h2><p><a href="http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml">http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml</a></p>
<ul>
<li>First create database of undesirable sequences: Download rRNA sequences of your taxa (or higher level) in fasta from SILVA, AMIGA, GenBank<ul>
<li>SILVA (rRNA) <a href="https://www.arb-silva.de/">https://www.arb-silva.de/</a>: sequence quality &gt;75, pintail quality &gt;75<ul>
<li>Then replace U by T in bash with:<div class="highlight"><pre><span></span>awk <span class="s1">&#39;/^&gt;/{}{gsub(&quot;U&quot;,&quot;T&quot;)}{print}&#39;</span> input.fasta &gt; output.fasta
</pre></div>
</li>
<li>Or in TextWrangler with (but not as good): <code>([^;])[U]([^0-9])</code></li>
</ul>
</li>
<li>GenBank: Be careful, avoid getting whole genomes- mitochondrial and nuclear, ribosomal proteins and mitochondria-like genes. Just got small subunits 5.8S, 5S</li>
<li>AMIGA (mtDNA) <a href="http://amiga.cbmeg.unicamp.br/">http://amiga.cbmeg.unicamp.br/</a><br></li>
</ul>
</li>
</ul>
<p><strong>This database is initially one fasta file with all sequences you want to avoid. It will be properly converted to an index file by Bowtie below.</strong></p>
<ul>
<li>Create Bowtie indices file with bowtie2-build command. From <strong>bowtie_base</strong> folder as<div class="highlight"><pre><span></span><span class="c1"># Only done once at start of project. Then proceed to next step to actually run Bowtie2 on assemblies</span>
sbatch b2build-rRNA.sh
sbatch b2build-mito.sh
</pre></div>
</li>
</ul>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span>%%bash
<span class="c1">#!/bin/bash</span>

<span class="c1">#SBATCH -J BuildIndex                           # Job name </span>
<span class="c1">#SBATCH -o B2Index.%A.out                       # File to which stdout will be written</span>
<span class="c1">#SBATCH -e B2Index.%A.err                       # File to which stderr will be written</span>
<span class="c1">#SBATCH --mail-type=ALL                         # BEGIN,END,ALL</span>
<span class="c1">#SBATCH --mail-user=tauanacunha@g.harvard.edu   # Email address</span>
<span class="c1">#SBATCH -N 1                                    # Ensure that all cores are on one machine</span>
<span class="c1">#SBATCH -n 1                                    # Number of cores/cpus</span>
<span class="c1">#SBATCH -t 00-00:30                             # Runtime in DD-HH:MM</span>
<span class="c1">#SBATCH --mem 200                               # Memory for all cores in Mbytes (--mem-per-cpu for MPI jobs)</span>
<span class="c1">#SBATCH -p serial_requeue                       # Partition shared, serial_requeue, unrestricted, test</span>


module load bowtie2/2.3.2-fasrc02

bowtie2-build mollusca_rRNA.fasta Mollusca_rRNA
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<ul>
<li><p>Then run Bowtie to filter these sequences out of your data</p>
</li>
<li><p>Input files need to be unzipped before Bowtie (automatically done inside my <em>bowtie.sh</em> script)</p>
</li>
</ul>
<div class="highlight"><pre><span></span><span class="c1"># Example how to unzip</span>
gunzip trimgalore_output_val_*.fq.gz
</pre></div>
<ul>
<li>Run bowtie from <strong>prep_for_assemblies</strong> as</li>
</ul>
<div class="highlight"><pre><span></span>sbatch --array<span class="o">=</span><span class="m">4</span>-6 ../scripts/bowtie.sh
</pre></div>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span>%%bash
<span class="c1">#!/bin/bash</span>

<span class="c1">#SBATCH -J Bowtie                               # Job name </span>
<span class="c1">#SBATCH -o Bowtie.%a.%A.out                     # File to which stdout will be written</span>
<span class="c1">#SBATCH -e Bowtie.%a.%A.err                     # File to which stderr will be written</span>
<span class="c1">#SBATCH --mail-type=ALL                         # BEGIN,END,ALL</span>
<span class="c1">#SBATCH --mail-user=tauanacunha@g.harvard.edu   # Email address</span>
<span class="c1">#SBATCH -N 1                                    # Ensure that all cores are on one machine</span>
<span class="c1">#SBATCH -n 4                                    # Number of cores/cpus</span>
<span class="c1">#SBATCH -t 01-00:00                             # Runtime in DD-HH:MM</span>
<span class="c1">#SBATCH --mem 1000                              # Memory for all cores in Mbytes (--mem-per-cpu for MPI jobs)</span>
<span class="c1">#SBATCH -p shared                               # Partition shared, serial_requeue, unrestricted, test</span>


module load bowtie2/2.3.2-fasrc02


<span class="c1"># Create variable to hold the directory name (which is the species name) and move inside folder</span>
<span class="nv">spp_dir</span><span class="o">=</span><span class="k">$(</span>sed -n <span class="s2">&quot;</span><span class="si">${</span><span class="nv">SLURM_ARRAY_TASK_ID</span><span class="si">}</span><span class="s2">p&quot;</span> folder-names.txt<span class="k">)</span>
<span class="nb">cd</span> <span class="nv">$spp_dir</span>
<span class="nb">echo</span> ENTERING <span class="nv">$spp_dir</span>                          <span class="c1"># Print that is entering species folder just as check point</span>
mkdir -p bowtie                                 <span class="c1"># Create directory for output if it is not already there</span>


gunzip trimG/*val_*.fq.gz

bowtie2 -k <span class="m">1</span> -t -p <span class="m">4</span> --al-conc bowtie/matches_rRNA.fq --un-conc bowtie/<span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>_rRNAcleaned.fq <span class="se">\</span>
  -x /n/Giribet_Lab/tauanajc/GASTROPODA/bowtie_base/Full-rRNA-Mollusca -1 trimG/*val_1.fq -2 trimG/*val_2.fq <span class="se">\</span>
  &gt; /dev/null

bowtie2 -k <span class="m">1</span> -t -p <span class="m">4</span> --al-conc bowtie/matches_mito.fq --un-conc bowtie/<span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>_Cleaned.fq <span class="se">\</span>
  -x /n/Giribet_Lab/tauanajc/GASTROPODA/bowtie_base/Mito-Mollusca -1 bowtie/*rRNAcleaned.1.fq -2 bowtie/*rRNAcleaned.2.fq <span class="se">\</span>
  &gt; /dev/null


<span class="c1"># Move .err and .out files to bowtie folder with rest of output</span>
mv ../Bowtie.<span class="nv">$SLURM_ARRAY_TASK_ID</span>.* ./bowtie/
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>-x [bt2-idx]<br>
The basename of the index for the reference genome (up to but not including the final .1.bt2 / .rev.1.bt2)</p>
<p>-1 [m1]<br>
Comma-separated list of files containing mate 1s (filename usually includes _1), e.g. -1 flyA_1.fq,flyB_1.fq. Sequences specified with this option must correspond file-for-file and read-for-read with those specified in [m2]. Reads may be a mix of different lengths</p>
<p>-2 [m2]<br>
Same as above, but mate 2s</p>
<p>-k [int]<br>
By default, bowtie2 searches for distinct, valid alignments for each read. When it finds a valid alignment, it continues looking for alignments that are nearly as good or better. The best alignment found is reported (randomly selected from among best if tied). When -k is specified, however, bowtie2 searches for at most [int] distinct, valid alignments for each read. For reads that have more than [int] distinct, valid alignments, bowtie2 does not guarantee that the [int] alignments reported are the best possible in terms of alignment score</p>
<p>-t/--time<br>
Print the wall-clock time required to load the index files and align the reads. This is printed to the "standard error" ("stderr"). Default: off</p>
<p>--un-conc [path]<br>
Write paired-end reads that fail to align concordantly to file(s) at [path]. .1 and .2 strings are added to the filename to distinguish which file contains mate #1 and mate #2. Reads written in this way will appear exactly as they did in the input files, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the inputs</p>
<p>--al-conc [path]<br>
Write paired-end reads that align concordantly at least once to file(s) at [path]. .1 and .2 strings are added to the filename to distinguish which file contains mate #1 and mate #2. Reads written in this way will appear exactly as they did in the input files, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the inputs</p>
<p>--al/--un<br>
For unpaired (after Trinity)</p>
<p>-q<br>
Reads (specified with [m1], [m2]) are FASTQ files. FASTQ files usually have extension .fq or .fastq. FASTQ is the default format</p>
<p>-p/--threads NTHREADS<br>
Launch NTHREADS parallel search threads (default: 1). Threads will run on separate processors/cores and synchronize when parsing reads and outputting alignments. Searching for alignments is highly parallel, and speedup is close to linear. Increasing -p increases Bowtie 2's memory footprint. E.g. when aligning to a human genome index, increasing -p from 1 to 8 increases the memory footprint by a few hundred megabytes</p>
<p>-f<br>
Reads (specified with [m1], [m2], [s]) are FASTA files. FASTA files usually have extension .fa, .fasta, .mfa, .fna or similar</p>
<p>&gt; /dev/null<br>
Redirects crazy standard output of Bowtie to null - does not save in .out file. Good because it's many GB of reads printed in the screen.</p>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<ol>
<li><strong>Copy sum of the % of matched reads from .err file of bowtie.</strong><br>
Run from <strong>prep_for_assemblies</strong>:</li>
</ol>
<div class="highlight"><pre><span></span><span class="k">while</span> <span class="nb">read</span> linha<span class="p">;</span> <span class="k">do</span>
<span class="nb">echo</span> <span class="nv">$linha</span> sum of rRNA and mito
grep <span class="s2">&quot;% overall alignment rate&quot;</span> <span class="si">${</span><span class="nv">linha</span><span class="si">}</span>/bowtie/Bow*.err <span class="p">|</span> cut -d % -f <span class="m">1</span> <span class="p">|</span> awk <span class="s1">&#39;{SUM += $1} END {print SUM}&#39;</span>
<span class="k">done</span> &lt; folder-names.txt

<span class="c1"># Option to see contributions of rRNA and mitochondrial, plus sum of both</span>
<span class="nb">echo</span> <span class="nv">$linha</span> rRNA, mito, SUM
grep <span class="s2">&quot;% overall alignment rate&quot;</span> <span class="si">${</span><span class="nv">linha</span><span class="si">}</span>/bowtie/Bow*.err <span class="p">|</span> cut -d % -f <span class="m">1</span> <span class="p">|</span> awk <span class="s1">&#39;{SUM += $1; print $1} END {print SUM}&#39;</span>
</pre></div>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h2 id="FastQC:-quality-control-of-filtered-data">FastQC: quality control of filtered data<a class="anchor-link" href="#FastQC:-quality-control-of-filtered-data">&#182;</a></h2><ul>
<li>Output folder: fastqc_reports</li>
<li>Run fastqc from <strong>prep_for_assemblies</strong> as</li>
</ul>
<div class="highlight"><pre><span></span>sbatch --array<span class="o">=</span><span class="m">4</span>-6 ../scripts/fastqcBow.sh
</pre></div>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span>%%bash
<span class="c1">#!/bin/bash</span>

<span class="c1">#SBATCH -J FastQCBow                            # Job name </span>
<span class="c1">#SBATCH -o FastQCBow.%a.%A.out                  # File to which stdout will be written</span>
<span class="c1">#SBATCH -e FastQCBow.%a.%A.err                  # File to which stderr will be written</span>
<span class="c1">#SBATCH --mail-type=ALL                         # BEGIN,END,ALL</span>
<span class="c1">#SBATCH --mail-user=tauanacunha@g.harvard.edu   # Email address</span>
<span class="c1">#SBATCH -N 1                                    # Ensure that all cores are on one machine</span>
<span class="c1">#SBATCH -n 2                                    # Number of cores/cpus</span>
<span class="c1">#SBATCH -t 00-04:00                             # Runtime in DD-HH:MM</span>
<span class="c1">#SBATCH --mem 600                               # Memory for all cores in Mbytes (--mem-per-cpu for MPI jobs)</span>
<span class="c1">#SBATCH -p serial_requeue                       # Partition shared, serial_requeue, unrestricted, test</span>


module load fastqc/0.11.5-fasrc01


<span class="c1"># Create variable to hold the directory name (which is the species name) and move inside folder</span>
<span class="nv">spp_dir</span><span class="o">=</span><span class="k">$(</span>sed -n <span class="s2">&quot;</span><span class="si">${</span><span class="nv">SLURM_ARRAY_TASK_ID</span><span class="si">}</span><span class="s2">p&quot;</span> folder-names.txt<span class="k">)</span>
<span class="nb">cd</span> <span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>/bowtie
<span class="nb">echo</span> ENTERING <span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>/bowtie                 <span class="c1"># Print that is entering species folder just as check point</span>


fastqc -o ../../../fastqc_reports -t <span class="m">2</span> --noextract --nogroup *Cleaned*.fq


<span class="c1"># Move .err and .out files to species bowtie folder</span>
mv ../../FastQCBow.<span class="nv">$SLURM_ARRAY_TASK_ID</span>.* ./
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<blockquote><p>After checking FastQC files, <strong>transfer all to permanent storage of fastqc_reports</strong>. From <strong>tauanajc</strong>:</p>
<div class="highlight"><pre><span></span>rsync -a fastqc_reports/* /n/Giribet_Lab/tauanajc/GASTROPODA/fastqc_reports/
</pre></div>
<p>SCRIPT IN THE END OF PIPELINE WILL DO THIS</p>
</blockquote>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h2 id="Trinity:-assemble">Trinity: assemble<a class="anchor-link" href="#Trinity:-assemble">&#182;</a></h2><p><a href="https://github.com/trinityrnaseq/trinityrnaseq/wiki">https://github.com/trinityrnaseq/trinityrnaseq/wiki</a><br>
<a href="https://groups.google.com/forum/#!forum/trinityrnaseq-users">https://groups.google.com/forum/#!forum/trinityrnaseq-users</a></p>
<ul>
<li>Run trinity from <strong>prep_for_assemblies</strong> as</li>
</ul>
<div class="highlight"><pre><span></span>sbatch --array<span class="o">=</span><span class="m">4</span>-6 ../scripts/trinity.sh
</pre></div>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span>%%bash
<span class="c1">#!/bin/bash</span>

<span class="c1">#SBATCH -J Trinity                              # Job name </span>
<span class="c1">#SBATCH -o Trinity.%a.%A.out                    # File to which stdout will be written</span>
<span class="c1">#SBATCH -e Trinity.%a.%A.err                    # File to which stderr will be written</span>
<span class="c1">#SBATCH --mail-type=ALL                         # BEGIN,END,ALL</span>
<span class="c1">#SBATCH --mail-user=tauanacunha@g.harvard.edu   # Email address</span>
<span class="c1">#SBATCH -N 1                                    # Ensure that all cores are on one machine</span>
<span class="c1">#SBATCH -n 12                                   # Number of cores/cpus</span>
<span class="c1">#SBATCH -t 04-00:00                             # Runtime in DD-HH:MM</span>
<span class="c1">#SBATCH --mem 150000                            # Memory for all cores in Mbytes (--mem-per-cpu for MPI jobs)</span>
<span class="c1">#SBATCH -p general                              # Partition shared, serial_requeue, unrestricted, test</span>


module load trinity/2.3.2-fasrc01


<span class="c1"># Create variable to hold the directory name (which is the species name) and move inside folder</span>
<span class="nv">spp_dir</span><span class="o">=</span><span class="k">$(</span>sed -n <span class="s2">&quot;</span><span class="si">${</span><span class="nv">SLURM_ARRAY_TASK_ID</span><span class="si">}</span><span class="s2">p&quot;</span> folder-names.txt<span class="k">)</span>
<span class="nb">cd</span> <span class="nv">$spp_dir</span>
<span class="nb">echo</span> ENTERING <span class="nv">$spp_dir</span>                          <span class="c1"># Print that is entering species folder just as check point</span>
mkdir -p trinity                                <span class="c1"># Create directory for output if it is not already there</span>


Trinity --max_memory 150G --CPU <span class="m">12</span> --output trinity/TEMP_trinity --seqType fq --SS_lib_type FR --full_cleanup <span class="se">\</span>
  --left bowtie/*Cleaned.1.fq --right bowtie/*Cleaned.2.fq <span class="se">\</span>
  --path_reinforcement_distance <span class="m">75</span> --bflyHeapSpaceMax 10G --bflyCalculateCPU

mv trinity/*.Trinity.fasta trinity/<span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>.Trinity.fasta   <span class="c1"># Renaming assembly fasta file</span>


<span class="c1"># Move .err and .out files to trinity folder with rest of output</span>
mv ../Trinity.<span class="nv">$SLURM_ARRAY_TASK_ID</span>.* ./trinity/
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span>%%bash
<span class="c1"># For SRA data, headers are problematic for Trinity, have space in the middle, and left and right read identifiers are</span>
<span class="c1"># right after the SRR/spp name (.1 and .2), making the name of reads in both files different. Trinity used to require</span>
<span class="c1"># identifiers /1 /2 at the end, but this version will work with our without them. So these two sed commands need to go</span>
<span class="c1"># in the beggining of the Trinity script, to correct headers. (Option is to download SRA data with the flag </span>
<span class="c1"># --defline-seq &#39;@$sn[_$rn]/$ri&#39; in the fast-dump command (already updated in my wget script) and then just use</span>
<span class="c1"># normal script for trinity)</span>

sed -i <span class="s1">&#39;s:\(.*\).1 \(.*\)\( length=.*\):\1-\2:g&#39;</span> bowtie/*Cleaned.1.fq
sed -i <span class="s1">&#39;s:\(.*\).2 \(.*\)\( length=.*\):\1-\2:g&#39;</span> bowtie/*Cleaned.2.fq
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>--seqType [string]<br>
Type of reads (fa, or fq)</p>
<p>--max_memory [string]<br>
Suggested max memory to use by Trinity where limiting can be enabled (jellyfish, sorting etc) provided in Gb of RAM, (ex: --max_memory 10G)</p>
<p>If paired reads:<br>
    --left  [string]    R1 reads, one or more file names (separated by commas, not spaces)<br>
    --right [string]    R2 reads, one or more file names (separated by commas, not spaces)</p>
<p>--SS_lib_type [string]<br>
Strand-specific RNA-Seq read orientation. If paired: RF or FR, if single: F or R.   (dUTP method = RF). See web documentation. (Wafergen Apollo is FR)</p>
<p>--CPU [int]<br>
Number of CPUs to use, default: 2</p>
<p>--output [string]<br>
Name of directory for output (will be created if it doesn't already exist) default (your current working directory: "/n/regal/Giribet_lab/tauanajc/trinity_out_dir". Note: must include 'trinity' in the name as a safety precaution!)</p>
<p>--full_cleanup<br>
Only retain the Trinity fasta file, rename as ${output_dir}.Trinity.fasta</p>
<p>--path_reinforcement_distance [int]<br>
Minimum overlap of reads with growing transcript path (default: PE: 75, SE: 25). Set to 1 for the most lenient path extension requirements</p>
<p>--bflyHeapSpaceMax [string]<br>
Java max heap space setting for butterfly (default: 4G) =&gt; yields command 'java -Xmx4G -jar Butterfly.jar ... $bfly_opts'</p>
<p>--bflyCalculateCPU<br>
Calculate CPUs based on 80% of max_memory divided by maxbflyHeapSpaceMax</p>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h3 id="Trinity-basic-statistics">Trinity basic statistics<a class="anchor-link" href="#Trinity-basic-statistics">&#182;</a></h3><p>Uses the <strong>util</strong> folder/scripts offered by Trinity. Only works if called from original folder because depends on libraries located there, so we use the full path to the scripts TrinityStats.pl and get_Trinity_gene_to_trans_map.pl</p>
<p>Assembly stats<br>
Gene-to-trans relationship - but result is the same as if don't use, so commented out.</p>
<ul>
<li>Run stats from <strong>prep_for_assemblies</strong> as<div class="highlight"><pre><span></span>sbatch --array<span class="o">=</span><span class="m">1</span>-4 ../scripts/stats-trinity.sh
</pre></div>
</li>
</ul>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span>%%bash
<span class="c1">#!/bin/bash</span>

<span class="c1">#SBATCH -J StatsTrinity                         # Job name </span>
<span class="c1">#SBATCH -o Stats.%A.out                         # File to which stdout will be written</span>
<span class="c1">#SBATCH -e Stats.%A.err                         # File to which stderr will be written</span>
<span class="c1">#SBATCH --mail-type=ALL                         # BEGIN,END,ALL</span>
<span class="c1">#SBATCH --mail-user=tauanacunha@g.harvard.edu   # Email address</span>
<span class="c1">#SBATCH -N 1                                    # Ensure that all cores are on one machine</span>
<span class="c1">#SBATCH -n 1                                    # Number of cores/cpus</span>
<span class="c1">#SBATCH -t 00-01:00                             # Runtime in DD-HH:MM</span>
<span class="c1">#SBATCH --mem 500                               # Memory for all cores in Mbytes (--mem-per-cpu for MPI jobs)</span>
<span class="c1">#SBATCH -p serial_requeue                       # Partition shared, serial_requeue, unrestricted, test</span>


module load perl/5.26.1-fasrc01


<span class="c1"># Create variable to hold the directory name (which is the species name) and move inside folder</span>
<span class="nv">spp_dir</span><span class="o">=</span><span class="k">$(</span>sed -n <span class="s2">&quot;</span><span class="si">${</span><span class="nv">SLURM_ARRAY_TASK_ID</span><span class="si">}</span><span class="s2">p&quot;</span> folder-names.txt<span class="k">)</span>

<span class="c1"># Stats and gene-to-trans map:</span>
perl /n/sw/fasrcsw/apps/Core/trinityrnaseq/2.3.2-fasrc01/util/TrinityStats.pl <span class="se">\</span>
<span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>/trinity/<span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>.Trinity.fasta &gt; <span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>/trinity/Assembly.Stats

<span class="c1">#perl /n/sw/fasrcsw/apps/Core/trinityrnaseq/2.2.0-fasrc01/util/support_scripts/get_Trinity_gene_to_trans_map.pl \</span>
<span class="c1">#${spp_dir}trinity/*.Trinity.fasta &gt; ${spp_dir}trinity/gene_trans_map.txt</span>
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<ol>
<li><strong>Copy info from .Stats to data table</strong><div class="highlight"><pre><span></span><span class="k">while</span> <span class="nb">read</span> linha<span class="p">;</span> <span class="k">do</span>
<span class="nb">echo</span> <span class="nv">$linha</span>
head -n <span class="m">23</span> <span class="nv">$linha</span>/trinity/Assembly.Stats <span class="p">|</span> grep -e <span class="s2">&quot;Total trinity&quot;</span> -e Percent -e <span class="s2">&quot;Contig N50&quot;</span> -e Median -e Average -e <span class="s2">&quot;Total assembled&quot;</span> <span class="p">|</span> cut -d : -f <span class="m">2</span> <span class="p">|</span> awk <span class="s1">&#39;{$1=$1};1&#39;</span> <span class="p">|</span> tr <span class="s1">&#39;\n&#39;</span> <span class="s1">&#39;\t&#39;</span>
<span class="nb">printf</span> <span class="s1">&#39;\n\n&#39;</span>
<span class="k">done</span> &lt; folder-names.txt <span class="c1"># Best option! Ready for ctrl+C ctrl+V in spreadsheet</span>
<span class="c1"># grep gets relevant lines for spreadsheet</span>
<span class="c1"># cut gets only the numbers</span>
<span class="c1"># awk removes spaces tabs etc</span>
<span class="c1"># tr changes line break for tabs, so it&#39;s ready to copy to table!</span>
<span class="k">for</span> d in */<span class="p">;</span> <span class="k">do</span> less <span class="nv">$d</span>/trinity/Assembly.Stats<span class="p">;</span> <span class="k">done</span> <span class="c1"># To see stats file from all directories</span>
<span class="k">while</span> <span class="nb">read</span> linha<span class="p">;</span> <span class="k">do</span> less <span class="nv">$linha</span>/trinity/Assembly.Stats<span class="p">;</span> <span class="k">done</span> &lt; <span class="m">105</span>-131.txt <span class="c1"># For specific directories</span>
</pre></div>
</li>
</ol>
<blockquote><p>After checking stats, <strong>copy Trinity.fasta files to permanent storage of raw_assemblies</strong>. From <strong>prep_for_assemblies</strong>:</p>
<div class="highlight"><pre><span></span><span class="k">for</span> d in */<span class="p">;</span> <span class="k">do</span> <span class="o">(</span>find <span class="si">${</span><span class="nv">d</span><span class="si">}</span>trinity/*.Trinity.fasta <span class="p">|</span> xargs -I <span class="o">{}</span> rsync -a <span class="o">{}</span> /n/Giribet_Lab/tauanajc/GASTROPODA/raw_assemblies/<span class="o">)</span> <span class="k">done</span>
</pre></div>
<p>SCRIPT IN THE END OF PIPELINE WILL DO THIS</p>
</blockquote>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h2 id="Bowtie:-remove-remaining-rRNA">Bowtie: remove remaining rRNA<a class="anchor-link" href="#Bowtie:-remove-remaining-rRNA">&#182;</a></h2><p>Here I also use <em>sed</em> to <strong>correct for an issue of Bowtie v2.2.9 with unpaired data</strong> - some headers/reads are truncated and the line break is missing.</p>
<p>Very fast, about one minute! Removes few sequences (2 to 50 in worst cases)</p>
<ul>
<li>Run bowtie from <strong>prep_for_assemblies</strong> as</li>
</ul>
<div class="highlight"><pre><span></span>sbatch --array<span class="o">=</span><span class="m">4</span>-6 ../scripts/rebowtie.sh
</pre></div>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span>%%bash
<span class="c1">#!/bin/bash</span>

<span class="c1">#SBATCH -J ReBowtie                             # Job name </span>
<span class="c1">#SBATCH -o ReBowtie.%a.%A.out                   # File to which stdout will be written</span>
<span class="c1">#SBATCH -e ReBowtie.%a.%A.err                   # File to which stderr will be written</span>
<span class="c1">#SBATCH --mail-type=ALL                         # BEGIN,END,ALL</span>
<span class="c1">#SBATCH --mail-user=tauanacunha@g.harvard.edu   # Email address</span>
<span class="c1">#SBATCH -N 1                                    # Ensure that all cores are on one machine</span>
<span class="c1">#SBATCH -n 4                                    # Number of cores/cpus</span>
<span class="c1">#SBATCH -t 00-01:30                             # Runtime in DD-HH:MM</span>
<span class="c1">#SBATCH --mem 1000                              # Memory for all cores in Mbytes (--mem-per-cpu for MPI jobs)</span>
<span class="c1">#SBATCH -p shared                               # Partition shared, serial_requeue, unrestricted, test</span>


module load bowtie2/2.3.2-fasrc02


<span class="c1"># Create variable to hold the directory name (which is the species name) and move inside folder</span>
<span class="nv">spp_dir</span><span class="o">=</span><span class="k">$(</span>sed -n <span class="s2">&quot;</span><span class="si">${</span><span class="nv">SLURM_ARRAY_TASK_ID</span><span class="si">}</span><span class="s2">p&quot;</span> folder-names.txt<span class="k">)</span>
<span class="nb">cd</span> <span class="nv">$spp_dir</span>
<span class="nb">echo</span> ENTERING <span class="nv">$spp_dir</span>                          <span class="c1"># Print that is entering species folder just as check point</span>
mkdir -p rebowtie                               <span class="c1"># Create directory for output if it is not already there</span>


bowtie2 -k <span class="m">1</span> -t -p <span class="m">4</span> -f --al rebowtie/matches_rRNA.fasta --un rebowtie/<span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>.Trinity.Cleaned.fasta <span class="se">\</span>
  -x /n/Giribet_Lab/tauanajc/GASTROPODA/bowtie_base/Full-rRNA-Mollusca -U trinity/<span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>.Trinity.fasta <span class="se">\</span>
  &gt; /dev/null

<span class="c1"># Corrects error in bowtie single reads (header truncation)</span>
sed -i <span class="s1">&#39;s:\([A-Z]\+\)\(&gt;TRINITY\):\1\n\2:g&#39;</span> rebowtie/<span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>.Trinity.Cleaned.fasta

<span class="c1"># Move .err and .out files to rebowtie folder with rest of output</span>
mv ../ReBowtie.<span class="nv">$SLURM_ARRAY_TASK_ID</span>.* ./rebowtie/
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h2 id="CD-HIT(-EST):-remove-redundant-sequences-(nucleotide-or-peptide)">CD-HIT(-EST): remove redundant sequences (nucleotide or peptide)<a class="anchor-link" href="#CD-HIT(-EST):-remove-redundant-sequences-(nucleotide-or-peptide)">&#182;</a></h2><p><a href="http://weizhongli-lab.org/lab-wiki/doku.php?id=cd-hit-user-guide">http://weizhongli-lab.org/lab-wiki/doku.php?id=cd-hit-user-guide</a></p>
<p>Here it is done on the nucleotide assembly. If decide to run CD-HIT on the peptide assembly, the following can be moved to after TransDecoder.</p>
<ul>
<li>Run cd-hit from <strong>prep_for_assemblies</strong> as</li>
</ul>
<div class="highlight"><pre><span></span>sbatch --array<span class="o">=</span><span class="m">4</span>-6 ../scripts/cdhit.sh
</pre></div>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span>%%bash
<span class="c1">#!/bin/bash</span>

<span class="c1">#SBATCH -J CD-HIT                               # Job name </span>
<span class="c1">#SBATCH -o CDHIT.%a.%A.out                      # File to which stdout will be written</span>
<span class="c1">#SBATCH -e CDHIT.%a.%A.err                      # File to which stderr will be written</span>
<span class="c1">#SBATCH --mail-type=ALL                         # BEGIN,END,ALL</span>
<span class="c1">#SBATCH --mail-user=tauanacunha@g.harvard.edu   # Email address</span>
<span class="c1">#SBATCH -N 1                                    # Ensure that all cores are on one machine</span>
<span class="c1">#SBATCH -n 1                                    # Number of cores/cpus</span>
<span class="c1">#SBATCH -t 01-00:00                             # Runtime in DD-HH:MM</span>
<span class="c1">#SBATCH --mem 2000                              # Memory for all cores in Mbytes (--mem-per-cpu for MPI jobs)</span>
<span class="c1">#SBATCH -p shared                               # Partition shared, serial_requeue, unrestricted, test</span>


module load cd-hit/4.6.4-fasrc02


<span class="c1"># Create variable to hold the directory name (which is the species name) and move inside folder</span>
<span class="nv">spp_dir</span><span class="o">=</span><span class="k">$(</span>sed -n <span class="s2">&quot;</span><span class="si">${</span><span class="nv">SLURM_ARRAY_TASK_ID</span><span class="si">}</span><span class="s2">p&quot;</span> folder-names.txt<span class="k">)</span>
mkdir -p <span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>/transdecoder
<span class="nb">cd</span> <span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>/transdecoder
<span class="nb">echo</span> ENTERING <span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>/transdecoder           <span class="c1"># Print that is entering species folder just as check point</span>


<span class="c1"># command for nucleotides, after Trinity, before TransDecoder</span>
cd-hit-est -c <span class="m">0</span>.95 -n <span class="m">10</span> -M <span class="m">2000</span> -i ../rebowtie/*.Trinity.Cleaned.fasta -o <span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>.Unique.fasta

<span class="c1"># command for peptides after Transdecoder</span>
<span class="c1"># cd-hit -c 0.98 -M 2000 -i *.Trinity.fasta.transdecoder.fasta -o ${spp_dir}.UniquePep.fasta</span>


<span class="c1"># Move .err and .out files to transdecoder folder with rest of output</span>
mv ../../CDHIT.<span class="nv">$SLURM_ARRAY_TASK_ID</span>.* ./
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>-i<br>
input filename in fasta format, required</p>
<p>-o<br>
output filename, required</p>
<p>-c<br>
sequence identity threshold, default 0.9. This is the default cd-hit's "global sequence identity" calculated as: number of identical amino acids in alignment divided by the full length of the shorter sequence</p>
<p>-n<br>
word_length, default 5 for cd-hit (for thresholds 0.7 ~ 1.0). For cd-hit-est: -n 10, 11 for thresholds 0.95 ~ 1.0, and -n 8,9 for thresholds 0.90 ~ 0.95</p>
<p>-M<br>
memory limit (in MB) for the program, default 800; 0 for unlimitted</p>
<p>-T<br>
number of threads, default 1; with 0, all CPUs will be used</p>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<ol>
<li><strong>Copy number of unique transcripts from .out file to data table</strong><div class="highlight"><pre><span></span><span class="k">for</span> d in */<span class="p">;</span> <span class="k">do</span> <span class="nb">echo</span> <span class="nv">$d</span> <span class="o">&amp;&amp;</span> tail -n <span class="m">8</span> <span class="nv">$d</span>/transdecoder/CDHIT*.out <span class="p">|</span> head -n <span class="m">2</span><span class="p">;</span> <span class="k">done</span>
<span class="c1">#OR</span>
<span class="k">while</span> <span class="nb">read</span> i<span class="p">;</span> <span class="k">do</span> <span class="nb">echo</span> <span class="nv">$i</span><span class="p">;</span> tail -n <span class="m">8</span> <span class="nv">$i</span>/transdecoder/CDHIT*.out <span class="p">|</span> head -n <span class="m">2</span><span class="p">;</span> <span class="k">done</span> &lt; <span class="m">53</span>-104.txt
</pre></div>
</li>
</ol>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h2 id="TransDecoder:-translate-contigs-into-aminoacids">TransDecoder: translate contigs into aminoacids<a class="anchor-link" href="#TransDecoder:-translate-contigs-into-aminoacids">&#182;</a></h2><p><a href="http://transdecoder.github.io">http://transdecoder.github.io</a></p>
<p>TransDecoder identifies candidate coding regions within transcript sequences.<br>
Only the cd-hit process can use multiple threads; the rest is not multithreaded yet.</p>
<ul>
<li>Run transdecoder from <strong>prep_for_assemblies</strong> as</li>
</ul>
<div class="highlight"><pre><span></span>sbatch --array<span class="o">=</span><span class="m">4</span>-6 ../scripts/transdecoder.sh
</pre></div>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span>%%bash
<span class="c1">#!/bin/bash</span>

<span class="c1">#SBATCH -J TransDecoder                         # Job name </span>
<span class="c1">#SBATCH -o Decoder.%a.%A.out                    # File to which stdout will be written</span>
<span class="c1">#SBATCH -e Decoder.%a.%A.err                    # File to which stderr will be written</span>
<span class="c1">#SBATCH --mail-type=ALL                         # BEGIN,END,ALL</span>
<span class="c1">#SBATCH --mail-user=tauanacunha@g.harvard.edu   # Email address</span>
<span class="c1">#SBATCH -N 1                                    # Ensure that all cores are on one machine</span>
<span class="c1">#SBATCH -n 1                                    # Number of cores/cpus</span>
<span class="c1">#SBATCH -t 00-10:00                             # Runtime in DD-HH:MM</span>
<span class="c1">#SBATCH --mem 2000                              # Memory for all cores in Mbytes (--mem-per-cpu for MPI jobs)</span>
<span class="c1">#SBATCH -p shared                               # Partition shared, serial_requeue, unrestricted, test</span>


module load TransDecoder/3.0.0-fasrc01


<span class="c1"># Create variable to hold the directory name (which is the species name) and move inside folder</span>
<span class="nv">spp_dir</span><span class="o">=</span><span class="k">$(</span>sed -n <span class="s2">&quot;</span><span class="si">${</span><span class="nv">SLURM_ARRAY_TASK_ID</span><span class="si">}</span><span class="s2">p&quot;</span> folder-names.txt<span class="k">)</span>
<span class="nb">cd</span> <span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>/transdecoder
<span class="nb">echo</span> ENTERING <span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>/transdecoder           <span class="c1"># Print that is entering species folder just as check point</span>


<span class="c1"># Step 1: Extract the long open reading frames</span>
TransDecoder.LongOrfs -t *.Unique.fasta
<span class="c1"># TransDecoder.LongOrfs -t ../trinity/*.Trinity.fasta # If right after Trinity</span>

<span class="c1"># Step 2: Predict the likely coding regions</span>
TransDecoder.Predict -t *.Unique.fasta
<span class="c1"># TransDecoder.Predict -t ../trinity/*.Trinity.fasta --single_best_orf # If right after Trinity</span>


<span class="c1"># mv *.pep ${spp_dir}.Trinity.fasta.transdecoder.fasta # Changing from .pep to .fasta; only needed if CD-HIT follows</span>


<span class="c1"># Move .err and .out files to transdecoder folder with rest of output</span>
mv ../../Decoder.<span class="nv">$SLURM_ARRAY_TASK_ID</span>.* ./
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>--single_best_orf<br>
Retain only single best ORF per transcript (Defined as (optionally pfam and/or blast support) longest ORF)- for TransDec.Predict</p>
<p>--gene_trans_map<br>
Gene-to-transcript identifier mapping file- for TransDecoder.LongOrfs (tab-delimited, gene_id[tab]trans_id[return])</p>
<ul>
<li>Outputs:</li>
</ul>
<p>transcripts.fasta.transdecoder.pep : peptide sequences for the final candidate ORFs; all shorter candidates within longer ORFs were removed<br>
transcripts.fasta.transdecoder.cds  : nucleotide sequences for coding regions of the final candidate ORFs<br>
transcripts.fasta.transdecoder.gff3 : positions within the target transcripts of the final selected ORFs<br>
transcripts.fasta.transdecoder.bed  : bed-formatted file describing ORF positions, best for viewing using GenomeView or IGV</p>
<p>A working directory (transcripts.transdecoder_dir/) is created to run and store intermediate files</p>
<ul>
<li>Important output is the .pep (I set so that the bash scrip already <strong>renames it to .fasta</strong>, when running right after Trinity and before CD-HIT)</li>
</ul>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h2 id="Isoform-selection">Isoform selection<a class="anchor-link" href="#Isoform-selection">&#182;</a></h2><p>Done with custom script from Chris Laumer + my modifications for compatibility with new Trinity header format.</p>
<p>Current version: <a href="https://github.com/tauanajc/Cunha_Giribet_2019_ProcRSocB"><strong>choose_longest_iso.py</strong></a> to choose the longest isoforms.</p>
<p>People in the lab used to run <em>singleline.pl</em> to transform wrapped fasta in single-line fasta. But my outputs are already in one line, so this perl script is not necessary. Also, it was written for older version of Trinity header, so wouldn't work anyway.</p>
<ul>
<li>Save output as .fa because OMA only reads that</li>
<li>Give the .fa file a good name, it is the final peptide assembly to be used for alignment and phylogenetic analysis</li>
</ul>
<ul>
<li>Run isoform selection from <strong>prep_for_assemblies</strong> as<div class="highlight"><pre><span></span>sbatch --array<span class="o">=</span><span class="m">1</span>-4 ../scripts/isoform.sh
</pre></div>
</li>
</ul>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span>%%bash
<span class="c1">#!/bin/bash</span>

<span class="c1">#SBATCH -J Isoform                              # Job name </span>
<span class="c1">#SBATCH -o Isoform.%a.%A.out                    # File to which stdout will be written</span>
<span class="c1">#SBATCH -e Isoform.%a.%A.err                    # File to which stderr will be written</span>
<span class="c1">#SBATCH --mail-type=ALL                         # BEGIN,END,ALL</span>
<span class="c1">#SBATCH --mail-user=tauanacunha@g.harvard.edu   # Email address</span>
<span class="c1">#SBATCH -N 1                                    # Ensure that all cores are on one machine</span>
<span class="c1">#SBATCH -n 1                                    # Number of cores/cpus</span>
<span class="c1">#SBATCH -t 00-01:00                             # Runtime in DD-HH:MM</span>
<span class="c1">#SBATCH --mem 500                               # Memory for all cores in Mbytes (--mem-per-cpu for MPI jobs)</span>
<span class="c1">#SBATCH -p serial_requeue                       # Partition shared, serial_requeue, unrestricted, test</span>


<span class="c1"># module load perl/5.26.1-fasrc01</span>

<span class="c1"># Create variable to hold the directory name (which is the species name) and move inside folder</span>
<span class="nv">spp_dir</span><span class="o">=</span><span class="k">$(</span>sed -n <span class="s2">&quot;</span><span class="si">${</span><span class="nv">SLURM_ARRAY_TASK_ID</span><span class="si">}</span><span class="s2">p&quot;</span> folder-names.txt<span class="k">)</span>

<span class="nb">echo</span> <span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>
python ../scripts/choose_longest_iso.py -i <span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>/transdecoder/*.transdecoder.pep <span class="se">\</span>
-o <span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>/transdecoder/<span class="si">${</span><span class="nv">spp_dir</span><span class="si">}</span>.PeptideAssembly.fa -l

<span class="c1"># perl ../scripts/singleline.pl input-LongestIso.fasta &gt; output-PeptideAssembly.fa</span>
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>-i/--input<br>
Fasta input file</p>
<p>-o/--output<br>
Fasta output file to be created</p>
<p>-t/--test<br>
Whether to run the test suite</p>
<p>-l/--longest<br>
Flag that allows you to retain only one protein per subcomponent</p>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<ol>
<li><strong>Copy initial and final number of peptides to data table from .out</strong></li>
</ol>
<blockquote><p><strong>Copy PeptideAssembly.fa files to permanent storage of ready_oma</strong>. From <strong>prep_for_assemblies</strong>:</p>
<div class="highlight"><pre><span></span><span class="k">for</span> d in */<span class="p">;</span> <span class="k">do</span> <span class="o">(</span>find <span class="si">${</span><span class="nv">d</span><span class="si">}</span>transdecoder/*.PeptideAssembly.fa <span class="p">|</span> xargs -I <span class="o">{}</span> rsync -a <span class="o">{}</span> /n/Giribet_Lab/tauanajc/GASTROPODA/ready_oma/<span class="o">)</span> <span class="k">done</span>
</pre></div>
<p>SCRIPT IN THE END OF PIPELINE WILL DO THIS</p>
</blockquote>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h2 id="Storing-important-files">Storing important files<a class="anchor-link" href="#Storing-important-files">&#182;</a></h2><ul>
<li>Run transfer from <strong>prep_for_assemblies</strong> as</li>
</ul>
<div class="highlight"><pre><span></span>sbatch ../scripts/perma-storage.sh
</pre></div>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span>%%bash
<span class="c1">#!/bin/bash</span>

<span class="c1">#SBATCH -J PermaStorage                         # Job name </span>
<span class="c1">#SBATCH -o PermaStorage.%A.out                  # File to which stdout will be written</span>
<span class="c1">#SBATCH -e PermaStorage.%A.err                  # File to which stderr will be written</span>
<span class="c1">#SBATCH --mail-type=ALL                         # BEGIN,END,ALL</span>
<span class="c1">#SBATCH --mail-user=tauanacunha@g.harvard.edu   # Email address</span>
<span class="c1">#SBATCH -N 1                                    # Ensure that all cores are on one machine</span>
<span class="c1">#SBATCH -n 1                                    # Number of cores/cpus</span>
<span class="c1">#SBATCH -t 00-05:00                             # Runtime in DD-HH:MM</span>
<span class="c1">#SBATCH --mem 500                               # Memory for all cores in Mbytes (--mem-per-cpu for MPI jobs)</span>
<span class="c1">#SBATCH -p shared                               # Partition shared, serial_requeue, unrestricted, test</span>


rm Stats.*
cat Isoform.*.out &gt;&gt; Isoforms.out
rm Isoform.*

<span class="nb">echo</span> TRANSFERRING IMPORTANT FILES TO PERMANENT STORAGE IN /n/Giribet_Lab/tauanajc/GASTROPODA/
rsync -a ../fastqc_reports/* /n/Giribet_Lab/tauanajc/GASTROPODA/fastqc_reports/
<span class="nb">echo</span> DONE FastQC files


find . -maxdepth <span class="m">3</span> -type f -name <span class="s1">&#39;*.Trinity.fasta&#39;</span> <span class="p">|</span> xargs -I <span class="o">{}</span> rsync -a <span class="o">{}</span> /n/Giribet_Lab/tauanajc/GASTROPODA/raw_assemblies/
<span class="nb">echo</span> DONE Trinity Assemblies
find . -name <span class="s1">&#39;*.PeptideAssembly.fa&#39;</span> <span class="p">|</span> xargs -I <span class="o">{}</span> rsync -a <span class="o">{}</span> /n/Giribet_Lab/tauanajc/GASTROPODA/ready_oma/
<span class="nb">echo</span> DONE Peptide Assemblies
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<ul>
<li>While first steps of analyses happen, keep intermediate files. Compress folder of each species and transfer to /n/Giribet_Lab done_assemblies folder.<br>
From <strong>prep_for_assemblies</strong>:</li>
</ul>
<div class="highlight"><pre><span></span><span class="k">for</span> i in Folder1 Folder2<span class="p">;</span> <span class="k">do</span> timestamp
tar cfz /n/Giribet_Lab/tauanajc/GASTROPODA/done_assemblies/<span class="si">${</span><span class="nv">i</span><span class="si">}</span>.tar.gz <span class="nv">$i</span>
<span class="nb">echo</span> <span class="nv">$i</span> OK
timestamp<span class="p">;</span> <span class="k">done</span>
</pre></div>
<p>Reduces the size to about half or one third. Takes a few hours per folder.</p>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h2 id="BUSCO:-check-assembly-quality">BUSCO: check assembly quality<a class="anchor-link" href="#BUSCO:-check-assembly-quality">&#182;</a></h2><p><a href="https://busco.ezlab.org">https://busco.ezlab.org</a><br>
<a href="https://gitlab.com/ezlab/busco">https://gitlab.com/ezlab/busco</a></p>
<p>BUSCO is a database of orthologs from different large sets of organisms. You can run your Trinity assemblies or the peptide assemblies against one of the databases to check how complete they are regarding the reference. I am doing it on the peptide assemblies, but instead of doing it for each species in separate, I am running it on the OMA/DB folder for all species, so more details are described in the Phylogenomics Pipeline jupyter notebook - check there.</p>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h1 id="------END------">----- END -----<a class="anchor-link" href="#------END------">&#182;</a></h1>
</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<hr>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h2 id="Entire-pipeline-at-once!-MASTER-SCRIPT">Entire pipeline at once! MASTER SCRIPT<a class="anchor-link" href="#Entire-pipeline-at-once!-MASTER-SCRIPT">&#182;</a></h2><p>Just give the number of species to be ran in the file folder-names.txt
<br>Start point is one folder per species with R1 and R2 fastq files in raw_reads folder.</p>
<ul>
<li>Run from <strong>prep_for_assemblies</strong> with number to be given to --array=:<div class="highlight"><pre><span></span>sbatch ../scripts/master-pipeline.sh <span class="m">1</span>-4
</pre></div>
</li>
</ul>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython2"><pre><span></span>%%bash
<span class="c1">#!/bin/bash</span>

<span class="c1">#SBATCH -J TransPipeline                        # Job name </span>
<span class="c1">#SBATCH -o TransPipe.%A.out                     # File to which stdout will be written</span>
<span class="c1">#SBATCH -e TransPipe.%A.err                     # File to which stderr will be written</span>
<span class="c1">#SBATCH --mail-type=ALL                         # BEGIN,END,ALL</span>
<span class="c1">#SBATCH --mail-user=tauanacunha@g.harvard.edu   # Email address</span>
<span class="c1">#SBATCH -N 1                                    # Ensure that all cores are on one machine</span>
<span class="c1">#SBATCH -n 1                                    # Number of cores/cpus</span>
<span class="c1">#SBATCH -t 00-01:00                             # Runtime in DD-HH:MM</span>
<span class="c1">#SBATCH --mem 300                               # Memory for all cores in Mbytes (--mem-per-cpu for MPI jobs)</span>
<span class="c1">#SBATCH -p test                                 # Partition shared, serial_requeue, unrestricted, test</span>


<span class="c1">#This script calls all required scripts for transcriptome pipeline</span>
<span class="c1">#This has to be run from prep_for_assemblies folder</span>

<span class="c1"># $1 = first argument in command line (numbers to be given to --array= in the following commands)</span>

<span class="c1"># Storing raw data was already done</span>

<span class="c1"># Merging reads F and R was already done</span>

<span class="c1">#step 1 - RCorrector</span>
<span class="nb">echo</span> STEP <span class="m">1</span> - RCorrector
sbatch --array<span class="o">=</span><span class="nv">$1</span> ../scripts/rcorrect.sh <span class="c1"># ../scripts/rcorrectSRA.sh for SRA data</span>
sleep <span class="m">20</span> <span class="c1"># wait some seconds so the previous job is submitted and can be retrieved with sacct</span>
<span class="nv">lastjob</span><span class="o">=</span><span class="k">$(</span>sacct<span class="p">|</span> awk <span class="s1">&#39;END{print $1}&#39;</span> <span class="p">|</span> cut -c <span class="m">1</span>-8<span class="k">)</span>

<span class="c1">#step 2 - TrimGalore</span>
<span class="nb">echo</span> STEP <span class="m">2</span> - TrimGalore <span class="c1"># ../scripts/trimgaloreDefault.sh for Illumina adaptors</span>
sbatch --dependency<span class="o">=</span>afterany:<span class="nv">$lastjob</span> --array<span class="o">=</span><span class="nv">$1</span> ../scripts/trimgaloreWafergen.sh
sleep <span class="m">20</span> <span class="c1"># wait some seconds so the previous job is submitted and can be retrieved with sacct</span>
<span class="nv">lastjob</span><span class="o">=</span><span class="k">$(</span>sacct<span class="p">|</span> awk <span class="s1">&#39;END{print $1}&#39;</span> <span class="p">|</span> cut -c <span class="m">1</span>-8<span class="k">)</span>

<span class="c1">#step 3 - FastQC on trimmed data</span>
<span class="nb">echo</span> STEP <span class="m">3</span> - FastQC on trimmed data
sbatch --dependency<span class="o">=</span>afterany:<span class="nv">$lastjob</span> --array<span class="o">=</span><span class="nv">$1</span> ../scripts/fastqcTrim.sh
sleep <span class="m">20</span>

<span class="c1">#step 4 - Bowtie</span>
<span class="nb">echo</span> STEP <span class="m">4</span> - Bowtie
sbatch --dependency<span class="o">=</span>afterany:<span class="nv">$lastjob</span> --array<span class="o">=</span><span class="nv">$1</span> ../scripts/bowtie.sh
sleep <span class="m">20</span> <span class="c1"># wait some seconds so the previous job is submitted and can be retrieved with sacct</span>
<span class="nv">lastjob</span><span class="o">=</span><span class="k">$(</span>sacct<span class="p">|</span> awk <span class="s1">&#39;END{print $1}&#39;</span> <span class="p">|</span> cut -c <span class="m">1</span>-8<span class="k">)</span>

<span class="c1">#step 5 - FastQC on bowtie cleaned data</span>
<span class="nb">echo</span> STEP <span class="m">5</span> - FastQC on bowtie cleaned data
sbatch --dependency<span class="o">=</span>afterany:<span class="nv">$lastjob</span> --array<span class="o">=</span><span class="nv">$1</span> ../scripts/fastqcBow.sh
sleep <span class="m">20</span>

<span class="c1">#step 6 - Trinity</span>
<span class="nb">echo</span> STEP <span class="m">6</span> - Trinity
sbatch --dependency<span class="o">=</span>afterany:<span class="nv">$lastjob</span> --array<span class="o">=</span><span class="nv">$1</span> ../scripts/trinity.sh <span class="c1"># ../scripts/trinitySRA.sh for SRA data with bad headers</span>
sleep <span class="m">20</span> <span class="c1"># wait some seconds so the previous job is submitted and can be retrieved with sacct</span>
<span class="nv">lastjob</span><span class="o">=</span><span class="k">$(</span>sacct<span class="p">|</span> awk <span class="s1">&#39;END{print $1}&#39;</span> <span class="p">|</span> cut -c <span class="m">1</span>-8<span class="k">)</span>

<span class="c1">#step 6.1 - Trinity Stats</span>
<span class="nb">echo</span> STEP <span class="m">6</span>.1 - Trinity Stats
sbatch --dependency<span class="o">=</span>afterany:<span class="nv">$lastjob</span> --array<span class="o">=</span><span class="nv">$1</span> ../scripts/stats-trinity.sh
sleep <span class="m">20</span>

<span class="c1">#step 7 - ReBowtie</span>
<span class="nb">echo</span> STEP <span class="m">7</span> - ReBowtie
sbatch --dependency<span class="o">=</span>afterany:<span class="nv">$lastjob</span> --array<span class="o">=</span><span class="nv">$1</span> ../scripts/rebowtie.sh
sleep <span class="m">20</span> <span class="c1"># wait some seconds so the previous job is submitted and can be retrieved with sacct</span>
<span class="nv">lastjob</span><span class="o">=</span><span class="k">$(</span>sacct<span class="p">|</span> awk <span class="s1">&#39;END{print $1}&#39;</span> <span class="p">|</span> cut -c <span class="m">1</span>-8<span class="k">)</span>

<span class="c1">#step 8 - CD-HIT-EST</span>
<span class="nb">echo</span> STEP <span class="m">8</span> - CD-HIT-EST
sbatch --dependency<span class="o">=</span>afterok:<span class="nv">$lastjob</span> --array<span class="o">=</span><span class="nv">$1</span> ../scripts/cdhit.sh
sleep <span class="m">20</span> <span class="c1"># wait some seconds so the previous job is submitted and can be retrieved with sacct</span>
<span class="nv">lastjob</span><span class="o">=</span><span class="k">$(</span>sacct<span class="p">|</span> awk <span class="s1">&#39;END{print $1}&#39;</span> <span class="p">|</span> cut -c <span class="m">1</span>-8<span class="k">)</span>

<span class="c1">#step 9 - TransDecoder</span>
<span class="nb">echo</span> STEP <span class="m">9</span> - TransDecoder
sbatch --dependency<span class="o">=</span>afterok:<span class="nv">$lastjob</span> --array<span class="o">=</span><span class="nv">$1</span> ../scripts/transdecoder.sh
sleep <span class="m">20</span> <span class="c1"># wait some seconds so the previous job is submitted and can be retrieved with sacct</span>
<span class="nv">lastjob</span><span class="o">=</span><span class="k">$(</span>sacct<span class="p">|</span> awk <span class="s1">&#39;END{print $1}&#39;</span> <span class="p">|</span> cut -c <span class="m">1</span>-8<span class="k">)</span>

<span class="c1">#step 10 - Isoform Selection</span>
<span class="nb">echo</span> STEP <span class="m">10</span> - Isoform Selection
sbatch --dependency<span class="o">=</span>afterok:<span class="nv">$lastjob</span> --array<span class="o">=</span><span class="nv">$1</span> ../scripts/isoform.sh
sleep <span class="m">20</span> <span class="c1"># wait some seconds so the previous job is submitted and can be retrieved with sacct</span>
<span class="nv">lastjob</span><span class="o">=</span><span class="k">$(</span>sacct<span class="p">|</span> awk <span class="s1">&#39;END{print $1}&#39;</span> <span class="p">|</span> cut -c <span class="m">1</span>-8<span class="k">)</span>


<span class="nb">echo</span> TRANSCRIPTOMES DONE


<span class="c1">#step 11 - Transfering important files to permanent storage</span>
<span class="nb">echo</span> STEP <span class="m">11</span> - Transfering to Permanent Storage
sbatch --dependency<span class="o">=</span>afterok:<span class="nv">$lastjob</span> --array<span class="o">=</span><span class="nv">$1</span> ../scripts/perma-storage.sh


<span class="nb">echo</span> TRANSFERENCE DONE
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<hr>

</div>
</div>
</div>
    </div>
  </div>
</body>

 
</html>