Add json output (--json)

README.md

@@ -38,9 +38,10 @@ print(fwd.tm_total) # 70.0
 ### CLI
 
 ```txt
-$ dir    tm   ttm     dg   pen  seq
-  FWD  60.8  67.0  -1.86  5.93  GGTCTCAATGAGACAATAGCACACAC
-  REV  60.8  65.8      0   3.2  GAAGACTTTCGTATGCTGACCTAG
+$ primers AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA -f GGTCTC -r GAAGAC
+  dir    tm   ttm     dg   pen  seq
+  FWD  61.8  67.6  -1.86  5.23  GGTCTCAATGAGACAATAGCACACACA
+  REV  61.9  66.5  -0.88  4.85  GAAGACTTTCGTATGCTGACCTAGC
 ```
 
 ```txt
@@ -50,14 +51,14 @@ usage: primers [-h] [-f SEQ] [-fl INT INT] [-r SEQ] [-rl INT INT] [-t SEQ] [--ve
 Create PCR primers for a DNA sequence.
 
 Logs the FWD and REV primer with columns:
-    dir, tm, ttm, dg, pen, seq
+    dir, tm, ttm, dg, p, seq
 
 Where:
     dir = FWD or REV.
     tm  = Melting temperature of the annealing/binding part of the primer (Celsius).
     ttm = The total melting temperature of the primer with added seq (Celsius).
     dg  = The minimum free energy of the primer's secondary structure (kcal/mol).
-    pen = The primer's penalty score. Lower is better.
+    p   = The primer's penalty score. Lower is better.
     seq = The sequence of the primer in the 5' to the 3' direction.
 
 positional arguments:

primers/main.py

@@ -1,11 +1,14 @@
 """Console entrypoint for creating PCR primers"""
 
 import argparse
+import json
 import sys
 from typing import List
 
 from . import __version__, primers
-from .primers import PRIMER_FMT
+
+
+"""{fwd} {tm} {tm_total} {gc} {dg} {penalty} {seq}"""
 
 
 def run():
@@ -25,9 +28,24 @@ def run():
         offtarget_check=args.t,
     )
 
-    print(PRIMER_FMT.format("dir", "tm", "ttm", "dg", "pen", "seq"))
-    print(fwd)
-    print(rev)
+    if args.json:
+        print(json.dumps([fwd.dict(), rev.dict()]))
+    else:
+        table_fmt = "{:>5} {:>5} {:>5} {:>3} {:>6} {:>5}  {}"
+        print(table_fmt.format("dir", "tm", "ttm", "gc", "dg", "p", "seq"))
+
+        for p in [fwd, rev]:
+            print(
+                table_fmt.format(
+                    "FWD" if p.fwd else "REV",
+                    p.tm,
+                    p.tm_total,
+                    p.gc,
+                    p.dg,
+                    p.scoring.penalty,
+                    p.seq,
+                )
+            )
 
 
 def parse_args(args: List[str]) -> argparse.Namespace:
@@ -46,13 +64,14 @@ def parse_args(args: List[str]) -> argparse.Namespace:
     parser = argparse.ArgumentParser(
         description="""Create PCR primers for a DNA sequence.
 
-Logs the FWD and REV primer with columns:
-    dir, tm, ttm, dg, pen, seq
+By default, the primers are logged in table format in rows:
+    dir, tm, ttm, gc, dg, pen, seq
 
 Where:
     dir = FWD or REV.
     tm  = The melting temperature of the annealing portion of the primer (Celsius).
     ttm = The total melting temperature of the primer with added seq (Celsius).
+    gc  = The GC ratio of the primer.
     dg  = The minimum free energy of the primer (kcal/mol).
     pen = The primer's penalty score. Lower is better.
     seq = The sequence of the primer in the 5' to the 3' direction.
@@ -98,6 +117,12 @@ def parse_args(args: List[str]) -> argparse.Namespace:
         default="",
         metavar="SEQ",
     )
+    parser.add_argument(
+        "-j",
+        "--json",
+        action=argparse.BooleanOptionalAction,
+        help="whether to write the primers in a JSON array",
+    )
     parser.add_argument(
         "--version", action="version", version="seqfold {ver}".format(ver=__version__)
     )

primers/offtargets.py → primers/off_targets.py

@@ -1,12 +1,12 @@
-"""Find offtargets.
+"""Find off-target binding sites.
 """
 
 from collections import defaultdict
 from typing import List, Dict
 
 
-def offtargets(seq: str, check_seq: str) -> List[int]:
-    """Return a list of offtarget counts for primers whose end is that index.
+def off_targets(seq: str, check_seq: str) -> List[int]:
+    """Return a list of off-target counts for primers whose end is that index.
 
     For example, offtarget_cache[20] -> returns the number of offtarget binding
     sites whose last bp ends in the 20th index of `seq`