Minor fixes to overall workflow to catch failed assemblies

README.md

@@ -20,4 +20,8 @@ If you are really impatient, check out our [quickstart](docs/quickstart.md) guid
 
 FooDMe2 is developed and supported by the following people and organizations:
 
-[Marc Höppner](https://github.com/marchoeppner), Landeslabor Schleswig-Holstein, [LSH](https://www.schleswig-holstein.de/DE/landesregierung/ministerien-behoerden/LLABOR)
+[Marc Höppner](https://github.com/marchoeppner), Landeslabor Schleswig-Holstein, [LSH](https://www.schleswig-holstein.de/DE/landesregierung/ministerien-behoerden/LLABOR)
+
+## Acknowledgements
+
+We thank the developers of the [AQUAMIS](https://gitlab.com/bfr_bioinformatics/AQUAMIS) pipeline for making some of the building blocks on which GABI is based publically available - specifically the ConfindR database and validation data for <i>Campylobacter spp.</i> as well as the reference intervals for a broad range of bacteria to determine assembly status. 

conf/modules.config

@@ -238,6 +238,15 @@ process {
             saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
         ]
     }
+    withName: MEDAKA_VARIANT {
+        ext.args = params.medaka_model
+        publishDir = [
+            path: { "${params.outdir}/samples/${meta.sample_id}/variants" },
+            mode: params.publish_dir_mode,
+            enabled: true,
+            saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+        ]
+    }
 
 
 }

conf/resources.config

@@ -187,7 +187,7 @@ params {
     campylobacter_jejuni = "${params.reference_base}/gabi/${params.reference_version}/chewbbaca/schema_4/Campylobacter_jejuni_INNUENDO_wgMLST"
     campylobacter_coli = "${params.reference_base}/gabi/${params.reference_version}/chewbbaca/schema_4/Campylobacter_jejuni_INNUENDO_wgMLST"
     campylobacter_lari = "${params.reference_base}/gabi/${params.reference_version}/chewbbaca/schema_4/Campylobacter_jejuni_INNUENDO_wgMLST"
-    escherichia_coli = "${params.reference_base}/gabi/${params.reference_version}/chewbbaca/schema_5_cgMLST"
+    escherichia_coli = "${params.reference_base}/gabi/${params.reference_version}/chewbbaca/schema_5/Escherichia_coli_INNUENDO_wgMLST"
     listeria_monocytogenes = "${params.reference_base}/gabi/${params.reference_version}/chewbbaca/schema_6/Listeria_monocytogenes_Pasteur_cgMLST"
     yersinia_enterocolitica = "${params.reference_base}/gabi/${params.reference_version}/chewbbaca/schema_7/Yersinia_enterocolitica_INNUENDO_wgMLST"
     salmonella_enterica = "${params.reference_base}/gabi/${params.reference_version}/chewbbaca/schema_8_cgMLST"

modules/cat_fastq/main.nf

@@ -23,7 +23,7 @@ process CAT_FASTQ {
 
     if (meta.single_end) {
         """
-        zcat ${reads.join(' ')} | gzip > ${prefix}.merged.fastq.gz
+        cat ${reads.join(' ')}  > ${prefix}.merged.fastq.gz
 
         cat <<-END_VERSIONS > versions.yml
         "${task.process}":
@@ -35,8 +35,8 @@ process CAT_FASTQ {
         def read2 = []
         readList.eachWithIndex { v, ix -> (ix & 1 ? read2 : read1) << v }
         """
-        zcat ${read1.join(' ')} | gzip > ${prefix}_1.merged.fastq.gz
-        zcat ${read2.join(' ')} | gzip > ${prefix}_2.merged.fastq.gz
+        cat ${read1.join(' ')} > ${prefix}_1.merged.fastq.gz
+        cat ${read2.join(' ')} > ${prefix}_2.merged.fastq.gz
 
         cat <<-END_VERSIONS > versions.yml
         "${task.process}":

modules/medaka/variant/environment.yml

@@ -0,0 +1,7 @@
+name: medaka_variant
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::medaka=2.0.1

modules/medaka/variant/main.nf

@@ -0,0 +1,37 @@
+process MEDAKA_VARIANT {
+    tag "$meta.sample_id"
+    label 'short_parallel'
+
+    conda "${moduleDir}/environment.yml"
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/medaka:2.0.1--py38h8774169_0' :
+        'quay.io/biocontainers/medaka:2.0.1--py38h8774169_0' }"
+
+    input:
+    tuple val(meta), path(reads), path(assembly)
+
+    output:
+    tuple val(meta), path("*annotated.vcf") , emit: vcf
+    path "versions.yml"                     , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    """
+    medaka_variant \\
+        -t $task.cpus \\
+        $args \\
+        -i $reads \\
+        -r $assembly \\
+        -o ./
+    
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        medaka: \$( medaka --version 2>&1 | sed 's/medaka //g' )
+    END_VERSIONS
+    """
+}

modules/medaka/variant/meta.yml

@@ -0,0 +1,45 @@
+name: medaka
+description: A tool to create consensus sequences and variant calls from nanopore sequencing data
+keywords:
+  - assembly
+  - polishing
+  - nanopore
+tools:
+  - medaka:
+      description: Neural network sequence error correction.
+      homepage: https://nanoporetech.github.io/medaka/index.html
+      documentation: https://nanoporetech.github.io/medaka/index.html
+      tool_dev_url: https://github.com/nanoporetech/medaka
+      licence: ["Mozilla Public License 2.0"]
+input:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - reads:
+      type: file
+      description: List of input nanopore fasta/FastQ files
+      pattern: "*.{fasta,fa,fastq,fastq.gz,fq,fq.gz}"
+  - assembly:
+      type: file
+      description: Genome assembly
+      pattern: "*.{fasta,fa}"
+output:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+  - assembly:
+      type: file
+      description: Polished genome assembly
+      pattern: "*.fa.gz"
+authors:
+  - "@avantonder"
+maintainers:
+  - "@avantonder"

modules/medaka/variant/tests/main.nf.test

@@ -0,0 +1,37 @@
+nextflow_process {
+
+    name "Test Process MEDAKA"
+    tag "modules_nfcore"
+    tag "modules"
+    tag "medaka"
+    script "../main.nf"
+    process "MEDAKA"
+
+    test("Medaka") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id:'test', single_end:true ], // meta map
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/nanopore/fastq/test.fastq.gz', checkIfExists: true),
+                    file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    path(process.out.assembly[0][1]).linesGzip.join()[0..99],
+                    process.out.versions
+                    ).match()
+                }
+            )
+        }
+
+    }
+
+}

modules/medaka/variant/tests/main.nf.test.snap

@@ -0,0 +1,15 @@
+{
+    "Medaka": {
+        "content": [
+            ">MT192765.1GTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTC",
+            [
+                "versions.yml:md5,739bb00a08faba4029f9f5ab9c15275a"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.8.4",
+            "nextflow": "24.04.4"
+        },
+        "timestamp": "2024-08-14T12:51:51.820749"
+    }
+}

modules/medaka/variant/tests/tags.yml

@@ -0,0 +1,2 @@
+medaka:
+  - modules/nf-core/medaka/**

modules/tabix/bgzip/environment.yml

@@ -0,0 +1,8 @@
+name: tabix_bgzip
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - bioconda::tabix=1.11
+  - bioconda::htslib=1.20

modules/tabix/bgzip/main.nf

@@ -0,0 +1,41 @@
+process TABIX_BGZIP {
+    tag "$meta.sample_id"
+    label 'short_serial'
+
+    conda "${moduleDir}/environment.yml"
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/htslib:1.20--h5efdd21_2' :
+        'quay.io/biocontainers/htslib:1.20--h5efdd21_2' }"
+
+    input:
+    tuple val(meta), path(input)
+
+    output:
+    tuple val(meta), path("${output}")    , emit: output
+    tuple val(meta), path("${output}.gzi"), emit: gzi, optional: true
+    path  "versions.yml"                  , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    prefix   = task.ext.prefix ?: "${meta.sample_id}"
+    in_bgzip = ["gz", "bgz", "bgzf"].contains(input.getExtension())
+    extension = in_bgzip ? input.getBaseName().tokenize(".")[-1] : input.getExtension()
+    output   = in_bgzip ? "${prefix}.${extension}" : "${prefix}.${extension}.gz"
+    command = in_bgzip ? '-d' : ''
+    // Name the index according to $prefix, unless a name has been requested
+    if ((args.matches("(^| )-i\\b") || args.matches("(^| )--index(\$| )")) && !args.matches("(^| )-I\\b") && !args.matches("(^| )--index-name\\b")) {
+        args = args + " -I ${output}.gzi"
+    }
+    """
+    bgzip $command -c $args -@${task.cpus} $input > ${output}
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        tabix: \$(echo \$(tabix -h 2>&1) | sed 's/^.*Version: //; s/ .*\$//')
+    END_VERSIONS
+    """
+
+}

modules/tabix/bgzip/meta.yml

@@ -0,0 +1,52 @@
+name: tabix_bgzip
+description: Compresses/decompresses files
+keywords:
+  - compress
+  - decompress
+  - bgzip
+  - tabix
+tools:
+  - bgzip:
+      description: |
+        Bgzip compresses or decompresses files in a similar manner to, and compatible with, gzip.
+      homepage: https://www.htslib.org/doc/tabix.html
+      documentation: http://www.htslib.org/doc/bgzip.html
+      doi: 10.1093/bioinformatics/btp352
+      licence: ["MIT"]
+input:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - input:
+      type: file
+      description: file to compress or to decompress
+output:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - output:
+      type: file
+      description: Output compressed/decompressed file
+      pattern: "*."
+  - gzi:
+      type: file
+      description: Optional gzip index file for compressed inputs
+      pattern: "*.gzi"
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+authors:
+  - "@joseespinosa"
+  - "@drpatelh"
+  - "@maxulysse"
+  - "@nvnieuwk"
+maintainers:
+  - "@joseespinosa"
+  - "@drpatelh"
+  - "@maxulysse"
+  - "@nvnieuwk"

modules/tabix/bgzip/tests/bgzip_compress.config

@@ -0,0 +1,5 @@
+process {
+    withName: TABIX_BGZIP {
+        ext.args = ' -i'
+    }
+}