nf-core 3.3.0 release #734

jfy133 · 2024-12-16T12:43:18Z

PR checklist

…subworkflow for alternative use of chopper for lambda-removal instead of nanolyse, and nanoq for longread filtering instead of filtlong

- Update modules - Update integration in mag and with other tools (bin_summary, gtdb-tk) - Update test - Update schema

Also, simplify bin_summary regarding bin qc

Co-authored-by: James A. Fellows Yates <[email protected]>

Post patch version bump

Add parameter to exclude unbinned data from post-binning steps

Bin QC Improvements

Fix input to single-end MEGAHIT runs

Add support for Prokka compliance mode

Important! Template update for nf-core/tools v3.1.0

Bump version for 3.3.0 release

github-actions · 2024-12-16T13:07:09Z

`nf-core pipelines lint` overall result: Passed ✅ ⚠️

Posted for pipeline commit bde62aa

+| ✅ 329 tests passed       |+
#| ❔   2 tests were ignored |#
!| ❗   5 tests had warnings |!

❗ Test warnings:

pipeline_todos - TODO string in main.nf: Remove this line if you don't need a FASTA file [TODO: try and test using for --host_fasta and --host_genome]
pipeline_todos - TODO string in main.nf: Optionally add in-text citation tools to this list.
pipeline_todos - TODO string in main.nf: Optionally add bibliographic entries to this list.
pipeline_todos - TODO string in main.nf: Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled!
pipeline_todos - TODO string in methods_description_template.yml: #Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline

❔ Tests ignored:

nextflow_config - Config default ignored: params.phix_reference
nextflow_config - Config default ignored: params.lambda_reference

✅ Tests passed:

files_exist - File found: .gitattributes
files_exist - File found: .gitignore
files_exist - File found: .nf-core.yml
files_exist - File found: .editorconfig
files_exist - File found: .prettierignore
files_exist - File found: .prettierrc.yml
files_exist - File found: CHANGELOG.md
files_exist - File found: CITATIONS.md
files_exist - File found: CODE_OF_CONDUCT.md
files_exist - File found: LICENSE or LICENSE.md or LICENCE or LICENCE.md
files_exist - File found: nextflow_schema.json
files_exist - File found: nextflow.config
files_exist - File found: README.md
files_exist - File found: .github/.dockstore.yml
files_exist - File found: .github/CONTRIBUTING.md
files_exist - File found: .github/ISSUE_TEMPLATE/bug_report.yml
files_exist - File found: .github/ISSUE_TEMPLATE/config.yml
files_exist - File found: .github/ISSUE_TEMPLATE/feature_request.yml
files_exist - File found: .github/PULL_REQUEST_TEMPLATE.md
files_exist - File found: .github/workflows/branch.yml
files_exist - File found: .github/workflows/ci.yml
files_exist - File found: .github/workflows/linting_comment.yml
files_exist - File found: .github/workflows/linting.yml
files_exist - File found: assets/email_template.html
files_exist - File found: assets/email_template.txt
files_exist - File found: assets/sendmail_template.txt
files_exist - File found: assets/nf-core-mag_logo_light.png
files_exist - File found: conf/modules.config
files_exist - File found: conf/test.config
files_exist - File found: conf/test_full.config
files_exist - File found: docs/images/nf-core-mag_logo_light.png
files_exist - File found: docs/images/nf-core-mag_logo_dark.png
files_exist - File found: docs/output.md
files_exist - File found: docs/README.md
files_exist - File found: docs/README.md
files_exist - File found: docs/usage.md
files_exist - File found: main.nf
files_exist - File found: assets/multiqc_config.yml
files_exist - File found: conf/base.config
files_exist - File found: conf/igenomes.config
files_exist - File found: conf/igenomes_ignored.config
files_exist - File found: .github/workflows/awstest.yml
files_exist - File found: .github/workflows/awsfulltest.yml
files_exist - File found: modules.json
files_exist - File found: ro-crate-metadata.json
files_exist - File not found check: .github/ISSUE_TEMPLATE/bug_report.md
files_exist - File not found check: .github/ISSUE_TEMPLATE/feature_request.md
files_exist - File not found check: .github/workflows/push_dockerhub.yml
files_exist - File not found check: .markdownlint.yml
files_exist - File not found check: .nf-core.yaml
files_exist - File not found check: .yamllint.yml
files_exist - File not found check: bin/markdown_to_html.r
files_exist - File not found check: conf/aws.config
files_exist - File not found check: docs/images/nf-core-mag_logo.png
files_exist - File not found check: lib/Checks.groovy
files_exist - File not found check: lib/Completion.groovy
files_exist - File not found check: lib/NfcoreTemplate.groovy
files_exist - File not found check: lib/Utils.groovy
files_exist - File not found check: lib/Workflow.groovy
files_exist - File not found check: lib/WorkflowMain.groovy
files_exist - File not found check: lib/WorkflowMag.groovy
files_exist - File not found check: parameters.settings.json
files_exist - File not found check: pipeline_template.yml
files_exist - File not found check: Singularity
files_exist - File not found check: lib/nfcore_external_java_deps.jar
files_exist - File not found check: .travis.yml
nextflow_config - Found nf-schema plugin
nextflow_config - Config variable found: manifest.name
nextflow_config - Config variable found: manifest.nextflowVersion
nextflow_config - Config variable found: manifest.description
nextflow_config - Config variable found: manifest.version
nextflow_config - Config variable found: manifest.homePage
nextflow_config - Config variable found: timeline.enabled
nextflow_config - Config variable found: trace.enabled
nextflow_config - Config variable found: report.enabled
nextflow_config - Config variable found: dag.enabled
nextflow_config - Config variable found: process.cpus
nextflow_config - Config variable found: process.memory
nextflow_config - Config variable found: process.time
nextflow_config - Config variable found: params.outdir
nextflow_config - Config variable found: params.input
nextflow_config - Config variable found: validation.help.enabled
nextflow_config - Config variable found: manifest.mainScript
nextflow_config - Config variable found: timeline.file
nextflow_config - Config variable found: trace.file
nextflow_config - Config variable found: report.file
nextflow_config - Config variable found: dag.file
nextflow_config - Config variable found: validation.help.beforeText
nextflow_config - Config variable found: validation.help.afterText
nextflow_config - Config variable found: validation.help.command
nextflow_config - Config variable found: validation.summary.beforeText
nextflow_config - Config variable found: validation.summary.afterText
nextflow_config - Config variable (correctly) not found: params.nf_required_version
nextflow_config - Config variable (correctly) not found: params.container
nextflow_config - Config variable (correctly) not found: params.singleEnd
nextflow_config - Config variable (correctly) not found: params.igenomesIgnore
nextflow_config - Config variable (correctly) not found: params.name
nextflow_config - Config variable (correctly) not found: params.enable_conda
nextflow_config - Config variable (correctly) not found: params.max_cpus
nextflow_config - Config variable (correctly) not found: params.max_memory
nextflow_config - Config variable (correctly) not found: params.max_time
nextflow_config - Config variable (correctly) not found: params.validationFailUnrecognisedParams
nextflow_config - Config variable (correctly) not found: params.validationLenientMode
nextflow_config - Config variable (correctly) not found: params.validationSchemaIgnoreParams
nextflow_config - Config variable (correctly) not found: params.validationShowHiddenParams
nextflow_config - Config timeline.enabled had correct value: true
nextflow_config - Config report.enabled had correct value: true
nextflow_config - Config trace.enabled had correct value: true
nextflow_config - Config dag.enabled had correct value: true
nextflow_config - Config manifest.name began with nf-core/
nextflow_config - Config variable manifest.homePage began with https://github.com/nf-core/
nextflow_config - Config dag.file ended with .html
nextflow_config - Config variable manifest.nextflowVersion started with >= or !>=
nextflow_config - Config manifest.version does not contain dev for release: 3.3.0
nextflow_config - Config params.custom_config_version is set to master
nextflow_config - Config params.custom_config_base is set to https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Lines for loading custom profiles found
nextflow_config - nextflow.config contains configuration profile test
nextflow_config - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/
nextflow_config - Config default value correct: params.custom_config_version= master
nextflow_config - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Config default value correct: params.publish_dir_mode= copy
nextflow_config - Config default value correct: params.max_multiqc_email_size= 25.MB
nextflow_config - Config default value correct: params.validate_params= true
nextflow_config - Config default value correct: params.pipelines_testdata_base_path= https://raw.githubusercontent.com/nf-core/test-datasets/
nextflow_config - Config default value correct: params.spades_fix_cpus= -1
nextflow_config - Config default value correct: params.spadeshybrid_fix_cpus= -1
nextflow_config - Config default value correct: params.metabat_rng_seed= 1
nextflow_config - Config default value correct: params.clip_tool= fastp
nextflow_config - Config default value correct: params.reads_minlength= 15
nextflow_config - Config default value correct: params.fastp_qualified_quality= 15
nextflow_config - Config default value correct: params.fastp_cut_mean_quality= 15
nextflow_config - Config default value correct: params.adapterremoval_minquality= 2
nextflow_config - Config default value correct: params.adapterremoval_adapter1= AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
nextflow_config - Config default value correct: params.adapterremoval_adapter2= AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
nextflow_config - Config default value correct: params.bbnorm_target= 100
nextflow_config - Config default value correct: params.bbnorm_min= 5
nextflow_config - Config default value correct: params.longreads_min_length= 1000
nextflow_config - Config default value correct: params.longreads_keep_percent= 90
nextflow_config - Config default value correct: params.longreads_length_weight= 10
nextflow_config - Config default value correct: params.longread_adaptertrimming_tool= porechop_abi
nextflow_config - Config default value correct: params.longread_filtering_tool= filtlong
nextflow_config - Config default value correct: params.gtdb_db= https://data.gtdb.ecogenomic.org/releases/release220/220.0/auxillary_files/gtdbtk_package/full_package/gtdbtk_r220_data.tar.gz
nextflow_config - Config default value correct: params.gtdbtk_min_completeness= 50.0
nextflow_config - Config default value correct: params.gtdbtk_max_contamination= 10.0
nextflow_config - Config default value correct: params.gtdbtk_min_perc_aa= 10.0
nextflow_config - Config default value correct: params.gtdbtk_min_af= 0.65
nextflow_config - Config default value correct: params.gtdbtk_pplacer_cpus= 1
nextflow_config - Config default value correct: params.genomad_min_score= 0.7
nextflow_config - Config default value correct: params.genomad_splits= 1
nextflow_config - Config default value correct: params.binning_map_mode= group
nextflow_config - Config default value correct: params.min_contig_size= 1500
nextflow_config - Config default value correct: params.min_length_unbinned_contigs= 1000000
nextflow_config - Config default value correct: params.max_unbinned_contigs= 100
nextflow_config - Config default value correct: params.bin_domain_classification_tool= tiara
nextflow_config - Config default value correct: params.tiara_min_length= 3000
nextflow_config - Config default value correct: params.binqc_tool= busco
nextflow_config - Config default value correct: params.checkm_download_url= https://zenodo.org/records/7401545/files/checkm_data_2015_01_16.tar.gz
nextflow_config - Config default value correct: params.checkm2_db_version= 5571251
nextflow_config - Config default value correct: params.refine_bins_dastool_threshold= 0.5
nextflow_config - Config default value correct: params.postbinning_input= raw_bins_only
nextflow_config - Config default value correct: params.gunc_database_type= progenomes
nextflow_config - Config default value correct: params.pydamage_accuracy= 0.5
nextflow_config - Config default value correct: params.freebayes_ploidy= 1
nextflow_config - Config default value correct: params.freebayes_min_basequality= 20
nextflow_config - Config default value correct: params.freebayes_minallelefreq= 0.33
nextflow_config - Config default value correct: params.bcftools_view_high_variant_quality= 30
nextflow_config - Config default value correct: params.bcftools_view_medium_variant_quality= 20
nextflow_config - Config default value correct: params.bcftools_view_minimal_allelesupport= 3
files_unchanged - .gitattributes matches the template
files_unchanged - .prettierrc.yml matches the template
files_unchanged - CODE_OF_CONDUCT.md matches the template
files_unchanged - LICENSE matches the template
files_unchanged - .github/.dockstore.yml matches the template
files_unchanged - .github/CONTRIBUTING.md matches the template
files_unchanged - .github/ISSUE_TEMPLATE/bug_report.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/config.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/feature_request.yml matches the template
files_unchanged - .github/PULL_REQUEST_TEMPLATE.md matches the template
files_unchanged - .github/workflows/branch.yml matches the template
files_unchanged - .github/workflows/linting_comment.yml matches the template
files_unchanged - .github/workflows/linting.yml matches the template
files_unchanged - assets/email_template.html matches the template
files_unchanged - assets/email_template.txt matches the template
files_unchanged - assets/sendmail_template.txt matches the template
files_unchanged - assets/nf-core-mag_logo_light.png matches the template
files_unchanged - docs/images/nf-core-mag_logo_light.png matches the template
files_unchanged - docs/images/nf-core-mag_logo_dark.png matches the template
files_unchanged - docs/README.md matches the template
files_unchanged - .gitignore matches the template
files_unchanged - .prettierignore matches the template
actions_ci - '.github/workflows/ci.yml' is triggered on expected events
actions_ci - '.github/workflows/ci.yml' checks minimum NF version
actions_awstest - '.github/workflows/awstest.yml' is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml does not use -profile test
readme - README Nextflow minimum version badge matched config. Badge: 24.04.2, Config: 24.04.2
readme - README Zenodo placeholder was replaced with DOI.
plugin_includes - No wrong validation plugin imports have been found
pipeline_name_conventions - Name adheres to nf-core convention
template_strings - Did not find any Jinja template strings (0 files)
schema_lint - Schema lint passed
schema_lint - Schema title + description lint passed
schema_lint - Input mimetype lint passed: 'text/csv'
schema_params - Schema matched params returned from nextflow config
system_exit - No System.exit calls found
actions_schema_validation - Workflow validation passed: linting.yml
actions_schema_validation - Workflow validation passed: branch.yml
actions_schema_validation - Workflow validation passed: fix-linting.yml
actions_schema_validation - Workflow validation passed: release-announcements.yml
actions_schema_validation - Workflow validation passed: awsfulltest.yml
actions_schema_validation - Workflow validation passed: template_version_comment.yml
actions_schema_validation - Workflow validation passed: download_pipeline.yml
actions_schema_validation - Workflow validation passed: ci.yml
actions_schema_validation - Workflow validation passed: clean-up.yml
actions_schema_validation - Workflow validation passed: awstest.yml
actions_schema_validation - Workflow validation passed: linting_comment.yml
merge_markers - No merge markers found in pipeline files
modules_json - Only installed modules found in modules.json
multiqc_config - assets/multiqc_config.yml found and not ignored.
multiqc_config - assets/multiqc_config.yml contains report_section_order
multiqc_config - assets/multiqc_config.yml contains export_plots
multiqc_config - assets/multiqc_config.yml contains report_comment
multiqc_config - assets/multiqc_config.yml follows the ordering scheme of the minimally required plugins.
multiqc_config - assets/multiqc_config.yml contains a matching 'report_comment'.
multiqc_config - assets/multiqc_config.yml contains 'export_plots: true'.
modules_structure - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL'
base_config - conf/base.config found and not ignored.
base_config - BOWTIE2_HOST_REMOVAL_BUILD found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
base_config - PORECHOP_PORECHOP found in conf/base.config and Nextflow scripts.
base_config - NANOLYSE found in conf/base.config and Nextflow scripts.
base_config - FILTLONG found in conf/base.config and Nextflow scripts.
base_config - CENTRIFUGE_CENTRIFUGE found in conf/base.config and Nextflow scripts.
base_config - KRAKEN2 found in conf/base.config and Nextflow scripts.
base_config - KRONA_KTIMPORTTAXONOMY found in conf/base.config and Nextflow scripts.
base_config - CAT_DB_GENERATE found in conf/base.config and Nextflow scripts.
base_config - CAT found in conf/base.config and Nextflow scripts.
base_config - GTDBTK_CLASSIFYWF found in conf/base.config and Nextflow scripts.
base_config - MEGAHIT found in conf/base.config and Nextflow scripts.
base_config - SPADES found in conf/base.config and Nextflow scripts.
base_config - SPADESHYBRID found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/base.config and Nextflow scripts.
base_config - METABAT2_METABAT2 found in conf/base.config and Nextflow scripts.
base_config - MAG_DEPTHS found in conf/base.config and Nextflow scripts.
base_config - BUSCO found in conf/base.config and Nextflow scripts.
base_config - MAXBIN2 found in conf/base.config and Nextflow scripts.
base_config - DASTOOL_DASTOOL found in conf/base.config and Nextflow scripts.
base_config - CHECKM2_PREDICT found in conf/base.config and Nextflow scripts.
modules_config - conf/modules.config found and not ignored.
modules_config - FASTQC_RAW found in conf/modules.config and Nextflow scripts.
modules_config - FASTP found in conf/modules.config and Nextflow scripts.
modules_config - ADAPTERREMOVAL_PE found in conf/modules.config and Nextflow scripts.
modules_config - ADAPTERREMOVAL_SE found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - FASTQC_TRIMMED found in conf/modules.config and Nextflow scripts.
modules_config - BBMAP_BBNORM found in conf/modules.config and Nextflow scripts.
modules_config - PORECHOP_PORECHOP found in conf/modules.config and Nextflow scripts.
modules_config - PORECHOP_ABI found in conf/modules.config and Nextflow scripts.
modules_config - FILTLONG found in conf/modules.config and Nextflow scripts.
modules_config - NANOQ found in conf/modules.config and Nextflow scripts.
modules_config - NANOLYSE found in conf/modules.config and Nextflow scripts.
modules_config - CHOPPER found in conf/modules.config and Nextflow scripts.
modules_config - NANOPLOT_RAW found in conf/modules.config and Nextflow scripts.
modules_config - NANOPLOT_FILTERED found in conf/modules.config and Nextflow scripts.
modules_config - CENTRIFUGE_CENTRIFUGE found in conf/modules.config and Nextflow scripts.
modules_config - CENTRIFUGE_KREPORT found in conf/modules.config and Nextflow scripts.
modules_config - KRAKEN2 found in conf/modules.config and Nextflow scripts.
modules_config - KREPORT2KRONA_CENTRIFUGE found in conf/modules.config and Nextflow scripts.
modules_config - KRONA_KTIMPORTTAXONOMY found in conf/modules.config and Nextflow scripts.
modules_config - MEGAHIT found in conf/modules.config and Nextflow scripts.
modules_config - METASPADES found in conf/modules.config and Nextflow scripts.
modules_config - METASPADESHYBRID found in conf/modules.config and Nextflow scripts.
modules_config - QUAST found in conf/modules.config and Nextflow scripts.
modules_config - GENOMAD_ENDTOEND found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - MAG_DEPTHS_PLOT found in conf/modules.config and Nextflow scripts.
modules_config - BIN_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_DB_PREPARATION found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_SAVE_DOWNLOAD found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - ARIA2_UNTAR found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM_LINEAGEWF found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM_QA found in conf/modules.config and Nextflow scripts.
modules_config - COMBINE_BINQC_TSV found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM2_DATABASEDOWNLOAD found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM2_PREDICT found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_DOWNLOADDB found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_RUN found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_MERGECHECKM found in conf/modules.config and Nextflow scripts.
modules_config - CAT_DB_GENERATE found in conf/modules.config and Nextflow scripts.
modules_config - CAT found in conf/modules.config and Nextflow scripts.
modules_config - CAT_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - GTDBTK_CLASSIFYWF found in conf/modules.config and Nextflow scripts.
modules_config - GTDBTK_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - PROKKA found in conf/modules.config and Nextflow scripts.
modules_config - PRODIGAL found in conf/modules.config and Nextflow scripts.
modules_config - FREEBAYES found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_VIEW found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_CONSENSUS found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_INDEX found in conf/modules.config and Nextflow scripts.
modules_config - PYDAMAGE_ANALYZE found in conf/modules.config and Nextflow scripts.
modules_config - PYDAMAGE_FILTER found in conf/modules.config and Nextflow scripts.
modules_config - SAMTOOLS_FAIDX found in conf/modules.config and Nextflow scripts.
modules_config - METABAT2_JGISUMMARIZEBAMCONTIGDEPTHS found in conf/modules.config and Nextflow scripts.
modules_config - METABAT2_METABAT2 found in conf/modules.config and Nextflow scripts.
modules_config - MAXBIN2 found in conf/modules.config and Nextflow scripts.
modules_config - ADJUST_MAXBIN2_EXT found in conf/modules.config and Nextflow scripts.
modules_config - CONCOCT_ found in conf/modules.config and Nextflow scripts.
modules_config - SPLIT_FASTA found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_METABAT2 found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_MAXBIN2 found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_CONCOCT found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_TIARA found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_DASTOOL found in conf/modules.config and Nextflow scripts.
modules_config - RENAME_POSTDASTOOL found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_TIARA found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_CLASSIFY found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - MMSEQS_DATABASES found in conf/modules.config and Nextflow scripts.
modules_config - METAEUK_EASYPREDICT found in conf/modules.config and Nextflow scripts.
modules_config - MULTIQC found in conf/modules.config and Nextflow scripts.
nfcore_yml - Repository type in .nf-core.yml is valid: pipeline
nfcore_yml - nf-core version in .nf-core.yml is set to the latest version: 3.1.0
version_consistency - Version tags are numeric and consistent between container, release tag and config.
included_configs - Pipeline config includes custom configs.

Run details

nf-core/tools version 3.1.0
Run at 2024-12-19 07:33:39

sateeshperi

minor suggestions.

Looks good overall. I would aim to have to local modules & sub-wfs nf-tests by next release.

docs/output.md

nextflow.config

Co-authored-by: Sateesh_Peri <[email protected]>

jfy133 · 2024-12-16T14:22:27Z

minor suggestions.

Looks good overall. I would aim to have to local modules & sub-wfs nf-tests by next release.

Thank you!

Slowly slowly getting there 😅 most of the local modules are being ripped and replaced, and I need pipeline tests done first becuase we are getting so many new contributors/ions, but I need to rejig the tests first , but that keeps getting pushed because we then get more bugs/contributors 😅 (I swear this pipeline is a full time job...)

charles-plessy

I looked at all the changes except for the nf-core modules and subworkflows, which I expect to be exact copies from nf-core/modules.

docs/output.md

subworkflows/local/utils_nfcore_mag_pipeline/main.nf

docs/output.md

CHANGELOG.md

charles-plessy

Thanks for the changes and explanations.

muabnezor and others added 30 commits October 14, 2024 08:19

install chopper from nf-core/chopper

ad89172

Add nanoq from nf-core/nanoq, and add code in longread_preprocessing …

c614c01

…subworkflow for alternative use of chopper for lambda-removal instead of nanolyse, and nanoq for longread filtering instead of filtlong

Fix config for modules nanoq and filtlong in modules.config

7102af4

Make it possible to use chopper as filtering tool as well

9bc8156

feat: Migrate from CheckM to CheckM2

53864d2

- Update modules - Update integration in mag and with other tools (bin_summary, gtdb-tk) - Update test - Update schema

fix: Bring back CheckM

ca2f97b

fix: One more thing

05e3393

fix: Linting

3e49dbf

fix: Option and checks in bin summary script

b1b6518

Fix: missing import

73b5794

docs: Output, changelog and citation for CheckM2

325310b

docs: readme

b88302a

Merge remote-tracking branch 'upstream/dev' into dev-checkm2

d62a671

docs: Update readme

3da7441

refactor: Merge checkm and checkm2 subworkflows in a single one

3d98415

Also, simplify bin_summary regarding bin qc

fix: Restore mistakenly deleted code

8b4fcc7

Testing param

6f38499

Complete schema description

dca7b71

Fix channel

dd7f135

Invert parameter

705198e

Merge branch 'dev' into add_chopper_nanoq

59aa4ad

Apply suggestions from code review

9504788

Co-authored-by: James A. Fellows Yates <[email protected]>

Update changelog

af7300f

Pre-commit

aa25201

Post patch bump

8c46072

Apply suggestions from code review

1a00c14

Merge pull request #712 from nf-core/post-patch-bump

f0ca539

Post patch version bump

Merge pull request #708 from dialvarezs/dev-exclude-unbinned

cd5ebae

Add parameter to exclude unbinned data from post-binning steps

Bin QC workflow

76dac5c

Merge remote-tracking branch 'upstream/dev' into dev-checkm2

0ebab07

jfy133 and others added 15 commits December 13, 2024 15:42

Merge branch 'dev' into dev-checkm2

009abd1

Update tests to integrate CheckM and CheckM2

a2afa5e

Fix for when checkm is not run for some bins

61c23fe

Merge pull request #707 from dialvarezs/dev-checkm2

c096f9a

Bin QC Improvements

Merge pull request #729 from nf-core/fix-megahit

7aebfa8

Fix input to single-end MEGAHIT runs

Re-add modules config loading

b0475ff

Fix linting

72a1037

Update CHANGELOG.md

4a282ec

Add support for prokka compliance mode

dfa5c49

Merge pull request #732 from nf-core/prokka-compliance

96f1e25

Add support for Prokka compliance mode

Update conf/modules.config

5162787

Merge pull request #731 from nf-core/nf-core-template-merge-3.1.0

2278c89

Important! Template update for nf-core/tools v3.1.0

Bump version, update workflow diagram, export 300dpi logos

a8b805e

[automated] Fix code linting

9598515

Merge pull request #733 from nf-core/bump-version-for-release

0ba597c

Bump version for 3.3.0 release

jfy133 requested a review from sateeshperi December 16, 2024 12:54

Remove typo in parameter

abcd63d

sateeshperi approved these changes Dec 16, 2024

View reviewed changes

docs/output.md Outdated Show resolved Hide resolved

docs/output.md Outdated Show resolved Hide resolved

nextflow.config Outdated Show resolved Hide resolved

nextflow.config Outdated Show resolved Hide resolved

Apply suggestions from code review

b0ed0c0

Co-authored-by: Sateesh_Peri <[email protected]>

Add simplified metro map

e571a28

charles-plessy reviewed Dec 19, 2024

View reviewed changes

docs/output.md Outdated Show resolved Hide resolved

subworkflows/local/utils_nfcore_mag_pipeline/main.nf Show resolved Hide resolved

jfy133 commented Dec 19, 2024

View reviewed changes

docs/output.md Outdated Show resolved Hide resolved

jfy133 requested a review from charles-plessy December 19, 2024 04:34

jfy133 commented Dec 19, 2024

View reviewed changes

CHANGELOG.md Outdated Show resolved Hide resolved

jfy133 added 2 commits December 19, 2024 05:36

Update CHANGELOG.md

3a39ca1

Update docs/output.md

bde62aa

charles-plessy approved these changes Dec 19, 2024

View reviewed changes

jfy133 merged commit 049ea0a into master Dec 19, 2024
38 checks passed

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

nf-core 3.3.0 release #734

nf-core 3.3.0 release #734

jfy133 commented Dec 16, 2024

github-actions bot commented Dec 16, 2024 •

edited

Loading

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

sateeshperi left a comment

jfy133 commented Dec 16, 2024 •

edited

Loading

charles-plessy left a comment

charles-plessy left a comment

nf-core 3.3.0 release #734

nf-core 3.3.0 release #734

Conversation

jfy133 commented Dec 16, 2024

PR checklist

github-actions bot commented Dec 16, 2024 • edited Loading

nf-core pipelines lint overall result: Passed ✅ ⚠️

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

sateeshperi left a comment

Choose a reason for hiding this comment

jfy133 commented Dec 16, 2024 • edited Loading

charles-plessy left a comment

Choose a reason for hiding this comment

charles-plessy left a comment

Choose a reason for hiding this comment

github-actions bot commented Dec 16, 2024 •

edited

Loading

`nf-core pipelines lint` overall result: Passed ✅ ⚠️

jfy133 commented Dec 16, 2024 •

edited

Loading